EMAIL THIS PAGE TO A FRIEND

XPO1

exportin 1 (CRM1 homolog, yeast)

Synonyms: CRM1 emb exp1
Gene ID:
Human(7514) Summary: The protein encoded by this gene mediates leucine-rich nuclear export signal (NES)-dependent protein transport. Exportin 1 specifically inhibits the nuclear export of Rev and U snRNAs. It is involved in the control of several cellular processes by controlling the localization of cyclin B, MPAK, and MAPKAP kinase 2. This protein also regulates NFAT and AP-1. [provided by RefSeq, Jul 2008]
Mouse(103573) exportin 1, CRM1 homolog (yeast)
Rat(85252) exportin 1, CRM1 homolog (yeast)
chicken(421192) exportin 1 (CRM1 homolog, yeast)
domestic cat(101084532) exportin 1 (CRM1 homolog, yeast)
dog(474609) exportin 1 (CRM1 homolog, yeast)
Domestic Rabbit(100343451) exportin 1 (CRM1 homolog, yeast)
domestic guinea pig(100718300) exportin 1 (CRM1 homolog, yeast)
cow(510568) exportin 1 (CRM1 homolog, yeast)
sheep(101118599) exportin 1 (CRM1 homolog, yeast)
123 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
E7909 Anti-Exportin 1/Crm1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
E7784 Anti-Exportin 1/Crm1 antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunoprecipitation, western blot pricing
AV40465 Anti-XPO1 antibody produced in rabbit affinity isolated antibody bovine, rabbit, canine, horse, human, mouse, rat
western blot pricing
SAB2102724 Anti-XPO1 antibody produced in rabbit affinity isolated antibody canine, rat, guinea pig, mouse, rabbit, bovine, human, horse
western blot pricing
HPA042933 Anti-XPO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
PLA0109 Rabbit anti-CRM1 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, chimpanzee, marmoset, human, mouse, rhesus monkey, primate, gibbon
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001035226 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001035226 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001035226 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003400 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003400 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003400 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003400 Rosetta Predictions human pricing
NM_053490 Rosetta Predictions rat pricing
NM_001035226 Rosetta Predictions mouse pricing
NM_134014 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003400 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084184 predicted 1761
2 SASI_Hs02_00335588 predicted 1276
3 SASI_Hs01_00084185 predicted 1944
4 SASI_Hs01_00084186 predicted 1561
5 SASI_Hs01_00084187 predicted 2467
6 SASI_Hs01_00084188 predicted 1772
7 SASI_Hs02_00335589 predicted 3521
8 SASI_Hs01_00084189 predicted 3546
9 SASI_Hs01_00084190 predicted 3702
10 SASI_Hs02_00335590 predicted 2510
11 SASI_Hs01_00084191 predicted 2065
12 SASI_Hs01_00084192 predicted 1796
13 SASI_Hs01_00084193 predicted 2289
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101163 predicted 2396
2 SASI_Rn01_00101164 predicted 1229
3 SASI_Rn02_00266088 predicted 1942
4 SASI_Rn01_00101165 predicted 1961
5 SASI_Rn01_00101166 predicted 895
6 SASI_Rn01_00101167 predicted 2804
7 SASI_Rn01_00101168 predicted 781
8 SASI_Rn01_00101169 predicted 2823
9 SASI_Rn01_00101170 predicted 1337
10 SASI_Rn01_00101171 predicted 805
11 SASI_Rn01_00101172 predicted 1619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001035226 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00289246 predicted 1023
2 SASI_Mm02_00289247 predicted 3020
3 SASI_Mm02_00289248 predicted 3099
4 SASI_Mm02_00289249 predicted 2170
5 SASI_Mm02_00289250 predicted 1535
6 SASI_Mm02_00289251 predicted 403
7 SASI_Mm02_00289252 predicted 2396
8 SASI_Mm02_00289253 predicted 746
9 SASI_Mm02_00289254 predicted 576
10 SASI_Mm02_00289255 predicted 3480
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134014 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339166 predicted 1260
2 SASI_Mm02_00339167 predicted 3261
3 SASI_Mm02_00339168 predicted 3338
4 SASI_Mm02_00339169 predicted 2401
5 SASI_Mm02_00339170 predicted 1774
6 SASI_Mm02_00339171 predicted 647
7 SASI_Mm02_00339172 predicted 2632
8 SASI_Mm02_00339173 predicted 979
9 SASI_Mm02_00339174 predicted 816
10 SASI_Mm02_00339175 predicted 3713
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001035226
XPO1 MISSION shRNA Bacterial Glycerol Stock
exportin 1 (CRM1 homolog, yeast)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035226.1-2602s21c1
Sequence:CCGGTTAGTACTATGGCCATTATTGCTCGAGCAATAATGGCCATAGTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000446624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035226.1-1602s21c1
Sequence:CCGGGATTATGTAGATACGGAAATACTCGAGTATTTCCGTATCTACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001035226.1-3973s1c1
Sequence:CCGGCCCATTGTAAAGCAACTTCAACTCGAGTTGAAGTTGCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-760s1c1
Sequence:CCGGCCCAAGTTAAAGCAAAGCATTCTCGAGAATGCTTTGCTTTAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-410s1c1
Sequence:CCGGGCAGAACATGAACACGAAATACTCGAGTATTTCGTGTTCATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-1433s1c1
Sequence:CCGGCGTGTTATCAAAGGTCCGTTTCTCGAGAAACGGACCTTTGATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-3099s1c1
Sequence:CCGGCCAGTTAACAACCAAATGTTTCTCGAGAAACATTTGGTTGTTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001035226
XPO1 MISSION shRNA shRNA Plasmid DNA
exportin 1 (CRM1 homolog, yeast)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035226.1-2602s21c1
Sequence:CCGGTTAGTACTATGGCCATTATTGCTCGAGCAATAATGGCCATAGTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000446624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035226.1-1602s21c1
Sequence:CCGGGATTATGTAGATACGGAAATACTCGAGTATTTCCGTATCTACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001035226.1-3973s1c1
Sequence:CCGGCCCATTGTAAAGCAACTTCAACTCGAGTTGAAGTTGCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-760s1c1
Sequence:CCGGCCCAAGTTAAAGCAAAGCATTCTCGAGAATGCTTTGCTTTAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-410s1c1
Sequence:CCGGGCAGAACATGAACACGAAATACTCGAGTATTTCGTGTTCATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-1433s1c1
Sequence:CCGGCGTGTTATCAAAGGTCCGTTTCTCGAGAAACGGACCTTTGATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-3099s1c1
Sequence:CCGGCCAGTTAACAACCAAATGTTTCTCGAGAAACATTTGGTTGTTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001035226
XPO1 MISSION shRNA Lentiviral Transduction Particles
exportin 1 (CRM1 homolog, yeast)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035226.1-2602s21c1
Sequence:CCGGTTAGTACTATGGCCATTATTGCTCGAGCAATAATGGCCATAGTACTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000446624    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001035226.1-1602s21c1
Sequence:CCGGGATTATGTAGATACGGAAATACTCGAGTATTTCCGTATCTACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126574    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001035226.1-3973s1c1
Sequence:CCGGCCCATTGTAAAGCAACTTCAACTCGAGTTGAAGTTGCTTTACAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-760s1c1
Sequence:CCGGCCCAAGTTAAAGCAAAGCATTCTCGAGAATGCTTTGCTTTAACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126577    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-410s1c1
Sequence:CCGGGCAGAACATGAACACGAAATACTCGAGTATTTCGTGTTCATGTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-1433s1c1
Sequence:CCGGCGTGTTATCAAAGGTCCGTTTCTCGAGAAACGGACCTTTGATAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001035226.1-3099s1c1
Sequence:CCGGCCAGTTAACAACCAAATGTTTCTCGAGAAACATTTGGTTGTTAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003400
VALIDATED
XPO1 MISSION shRNA Bacterial Glycerol Stock
exportin 1 (CRM1 homolog, yeast)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-1638s21c1
Sequence:CCGGATTCGACTTGCGTACTCAAATCTCGAGATTTGAGTACGCAAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-3687s21c1
Sequence:CCGGCCTCACCTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003400.3-4500s21c1
Sequence:CCGGCCATTGTAAAGCGACTTCAAACTCGAGTTTGAAGTCGCTTTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-864s21c1
Sequence:CCGGGCTCAAGAAGTACTGACACATCTCGAGATGTGTCAGTACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-3114s1c1
Sequence:CCGGGCAGGTGAAGACACTTCTGATCTCGAGATCAGAAGTGTCTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-2997s1c1
Sequence:CCGGCCTCACCTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-3811s1c1
Sequence:CCGGCCATTGTAAAGCGACTTCAAACTCGAGTTTGAAGTCGCTTTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-2861s1c1
Sequence:CCGGGCATGCATCAATTCTTGCATACTCGAGTATGCAAGAATTGATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-3063s1c1
Sequence:CCGGCCTGCTTTCAAGGAACATTTACTCGAGTAAATGTTCCTTGAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003400.2-1257s1c1
Sequence:CCGGCAGCTATATTTGCCCATGTTACTCGAGTAACATGGGCAAATATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003400.2-3951s1c1
Sequence:CCGGCCTTCATTAACTCGAAGTGAACTCGAGTTCACTTCGAGTTAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-3938s1c1
Sequence:CCGGGCTCATTTGTGAGCCTTCATTCTCGAGAATGAAGGCTCACAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-174s1c1
Sequence:CCGGGCTCAAGAAGTACTGACACATCTCGAGATGTGTCAGTACTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-1917s1c1
Sequence:CCGGCCTCAACAGGTTCATACGTTTCTCGAGAAACGTATGAACCTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003400
VALIDATED
XPO1 MISSION shRNA shRNA Plasmid DNA
exportin 1 (CRM1 homolog, yeast)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-1638s21c1
Sequence:CCGGATTCGACTTGCGTACTCAAATCTCGAGATTTGAGTACGCAAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-3687s21c1
Sequence:CCGGCCTCACCTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003400.3-4500s21c1
Sequence:CCGGCCATTGTAAAGCGACTTCAAACTCGAGTTTGAAGTCGCTTTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-864s21c1
Sequence:CCGGGCTCAAGAAGTACTGACACATCTCGAGATGTGTCAGTACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-3114s1c1
Sequence:CCGGGCAGGTGAAGACACTTCTGATCTCGAGATCAGAAGTGTCTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-2997s1c1
Sequence:CCGGCCTCACCTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-3811s1c1
Sequence:CCGGCCATTGTAAAGCGACTTCAAACTCGAGTTTGAAGTCGCTTTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-2861s1c1
Sequence:CCGGGCATGCATCAATTCTTGCATACTCGAGTATGCAAGAATTGATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-3063s1c1
Sequence:CCGGCCTGCTTTCAAGGAACATTTACTCGAGTAAATGTTCCTTGAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003400.2-1257s1c1
Sequence:CCGGCAGCTATATTTGCCCATGTTACTCGAGTAACATGGGCAAATATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003400.2-3951s1c1
Sequence:CCGGCCTTCATTAACTCGAAGTGAACTCGAGTTCACTTCGAGTTAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-3938s1c1
Sequence:CCGGGCTCATTTGTGAGCCTTCATTCTCGAGAATGAAGGCTCACAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-174s1c1
Sequence:CCGGGCTCAAGAAGTACTGACACATCTCGAGATGTGTCAGTACTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-1917s1c1
Sequence:CCGGCCTCAACAGGTTCATACGTTTCTCGAGAAACGTATGAACCTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003400
VALIDATED
XPO1 MISSION shRNA Lentiviral Transduction Particles
exportin 1 (CRM1 homolog, yeast)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338401    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-1638s21c1
Sequence:CCGGATTCGACTTGCGTACTCAAATCTCGAGATTTGAGTACGCAAGTCGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338399    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-3687s21c1
Sequence:CCGGCCTCACCTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAGGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338464    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003400.3-4500s21c1
Sequence:CCGGCCATTGTAAAGCGACTTCAAACTCGAGTTTGAAGTCGCTTTACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338462    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_003400.3-864s21c1
Sequence:CCGGGCTCAAGAAGTACTGACACATCTCGAGATGTGTCAGTACTTCTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-3114s1c1
Sequence:CCGGGCAGGTGAAGACACTTCTGATCTCGAGATCAGAAGTGTCTTCACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-2997s1c1
Sequence:CCGGCCTCACCTACAAGATGCTCAACTCGAGTTGAGCATCTTGTAGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150975    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-3811s1c1
Sequence:CCGGCCATTGTAAAGCGACTTCAAACTCGAGTTTGAAGTCGCTTTACAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151579    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-2861s1c1
Sequence:CCGGGCATGCATCAATTCTTGCATACTCGAGTATGCAAGAATTGATGCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-3063s1c1
Sequence:CCGGCCTGCTTTCAAGGAACATTTACTCGAGTAAATGTTCCTTGAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003400.2-1257s1c1
Sequence:CCGGCAGCTATATTTGCCCATGTTACTCGAGTAACATGGGCAAATATAGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152210    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003400.2-3951s1c1
Sequence:CCGGCCTTCATTAACTCGAAGTGAACTCGAGTTCACTTCGAGTTAATGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152787    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-3938s1c1
Sequence:CCGGGCTCATTTGTGAGCCTTCATTCTCGAGAATGAAGGCTCACAAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_003400.2-174s1c1
Sequence:CCGGGCTCAAGAAGTACTGACACATCTCGAGATGTGTCAGTACTTCTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153707    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003400.2-1917s1c1
Sequence:CCGGCCTCAACAGGTTCATACGTTTCTCGAGAAACGTATGAACCTGTTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks