EMAIL THIS PAGE TO A FRIEND

XPO4

exportin 4

Synonyms: exp4
UniProtKB ID: Q9C0E2, Q5VUZ5, Q8N3V6, Q9H934
Gene ID:
Human(64328) Summary: XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]
Mouse(57258) exportin 4
Rat(290280) exportin 4
Zebrafish(324342) exportin 4
Horse(100054789) exportin 4
dog(477344) exportin 4
chicken(428081) exportin 4
cow(506392) exportin 4
sheep(101118197) exportin 4
143 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA053768 Anti-XPO4 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4200417 Monoclonal Anti-XPO4 antibody produced in mouse ~1.0 mg/mL, clone XP-12, purified immunoglobulin human, chicken, bovine, monkey, canine, hamster
immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022459 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022459 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022459 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU053791 MISSION® esiRNA esiRNA human XPO4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022459 Rosetta Predictions human pricing
NM_001106042 Rosetta Predictions rat pricing
NM_020506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022459 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132639 predicted 2912
2 SASI_Hs01_00132640 predicted 990
3 SASI_Hs01_00132641 predicted 1306
4 SASI_Hs01_00132642 predicted 381
5 SASI_Hs01_00132644 predicted 2338
6 SASI_Hs01_00132645 predicted 2441
7 SASI_Hs01_00132646 predicted 2044
8 SASI_Hs01_00132647 predicted 2532
9 SASI_Hs01_00132648 predicted 3310
10 SASI_Hs02_00355729 predicted 221
11 SASI_Hs01_00132643 predicted 1162
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106042 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00215052 predicted 2699
2 SASI_Rn02_00215053 predicted 2957
3 SASI_Rn02_00215054 predicted 3483
4 SASI_Rn02_00215055 predicted 730
5 SASI_Rn02_00215056 predicted 1579
6 SASI_Rn02_00215057 predicted 2491
7 SASI_Rn02_00215058 predicted 1224
8 SASI_Rn02_00215059 predicted 571
9 SASI_Rn02_00215060 predicted 1531
10 SASI_Rn02_00215061 predicted 1753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325559 predicted 2585
2 SASI_Mm01_00101977 predicted 1695
3 SASI_Mm01_00101978 predicted 2300
4 SASI_Mm01_00101979 predicted 1028
5 SASI_Mm01_00101980 predicted 1558
6 SASI_Mm01_00101981 predicted 378
7 SASI_Mm01_00101982 predicted 211
8 SASI_Mm01_00101983 predicted 2746
9 SASI_Mm01_00101984 predicted 528
10 SASI_Mm01_00101985 predicted 2075
11 SASI_Mm01_00101976 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020506
XPO4 MISSION shRNA Bacterial Glycerol Stock
exportin 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1640s1c1
Sequence:CCGGGCTACCTCTTAGCTGATGATACTCGAGTATCATCAGCTAAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1675s1c1
Sequence:CCGGCCGCTAATACCTCCAGAAATACTCGAGTATTTCTGGAGGTATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1159s1c1
Sequence:CCGGGCGTTGGAAGAAGTGCTTGATCTCGAGATCAAGCACTTCTTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-745s1c1
Sequence:CCGGGCTATGTTTGAATCCTCACAACTCGAGTTGTGAGGATTCAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-2513s1c1
Sequence:CCGGGCATTGGTTTAATGGAAGTTTCTCGAGAAACTTCCATTAAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1640s21c1
Sequence:CCGGGCTACCTCTTAGCTGATGATACTCGAGTATCATCAGCTAAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1159s21c1
Sequence:CCGGGCGTTGGAAGAAGTGCTTGATCTCGAGATCAAGCACTTCTTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-745s21c1
Sequence:CCGGGCTATGTTTGAATCCTCACAACTCGAGTTGTGAGGATTCAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1675s21c1
Sequence:CCGGCCGCTAATACCTCCAGAAATACTCGAGTATTTCTGGAGGTATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-2513s21c1
Sequence:CCGGGCATTGGTTTAATGGAAGTTTCTCGAGAAACTTCCATTAAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020506
XPO4 MISSION shRNA shRNA Plasmid DNA
exportin 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1640s1c1
Sequence:CCGGGCTACCTCTTAGCTGATGATACTCGAGTATCATCAGCTAAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1675s1c1
Sequence:CCGGCCGCTAATACCTCCAGAAATACTCGAGTATTTCTGGAGGTATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1159s1c1
Sequence:CCGGGCGTTGGAAGAAGTGCTTGATCTCGAGATCAAGCACTTCTTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-745s1c1
Sequence:CCGGGCTATGTTTGAATCCTCACAACTCGAGTTGTGAGGATTCAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-2513s1c1
Sequence:CCGGGCATTGGTTTAATGGAAGTTTCTCGAGAAACTTCCATTAAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1640s21c1
Sequence:CCGGGCTACCTCTTAGCTGATGATACTCGAGTATCATCAGCTAAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1159s21c1
Sequence:CCGGGCGTTGGAAGAAGTGCTTGATCTCGAGATCAAGCACTTCTTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-745s21c1
Sequence:CCGGGCTATGTTTGAATCCTCACAACTCGAGTTGTGAGGATTCAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1675s21c1
Sequence:CCGGCCGCTAATACCTCCAGAAATACTCGAGTATTTCTGGAGGTATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-2513s21c1
Sequence:CCGGGCATTGGTTTAATGGAAGTTTCTCGAGAAACTTCCATTAAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020506
XPO4 MISSION shRNA Lentiviral Transduction Particles
exportin 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105645    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1640s1c1
Sequence:CCGGGCTACCTCTTAGCTGATGATACTCGAGTATCATCAGCTAAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105647    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1675s1c1
Sequence:CCGGCCGCTAATACCTCCAGAAATACTCGAGTATTTCTGGAGGTATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105648    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-1159s1c1
Sequence:CCGGGCGTTGGAAGAAGTGCTTGATCTCGAGATCAAGCACTTCTTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-745s1c1
Sequence:CCGGGCTATGTTTGAATCCTCACAACTCGAGTTGTGAGGATTCAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020506.1-2513s1c1
Sequence:CCGGGCATTGGTTTAATGGAAGTTTCTCGAGAAACTTCCATTAAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1640s21c1
Sequence:CCGGGCTACCTCTTAGCTGATGATACTCGAGTATCATCAGCTAAGAGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324183    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1159s21c1
Sequence:CCGGGCGTTGGAAGAAGTGCTTGATCTCGAGATCAAGCACTTCTTCCAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-745s21c1
Sequence:CCGGGCTATGTTTGAATCCTCACAACTCGAGTTGTGAGGATTCAAACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-1675s21c1
Sequence:CCGGCCGCTAATACCTCCAGAAATACTCGAGTATTTCTGGAGGTATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020506.1-2513s21c1
Sequence:CCGGGCATTGGTTTAATGGAAGTTTCTCGAGAAACTTCCATTAAACCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022459
VALIDATED
XPO4 MISSION shRNA Bacterial Glycerol Stock
exportin 4
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000165701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022459.3-2387s1c1
Sequence:CCGGCCCAGATTGACAACGTAGCAACTCGAGTTGCTACGTTGTCAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-2518s1c1
Sequence:CCGGGCACATAAACAGATATGCTATCTCGAGATAGCATATCTGTTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-2957s1c1
Sequence:CCGGCCCTAGAATTAGGAATGACATCTCGAGATGTCATTCCTAATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022459.3-1604s1c1
Sequence:CCGGCTCCGCTAATACCTCCAGAAACTCGAGTTTCTGGAGGTATTAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-6989s1c1
Sequence:CCGGCCAGAGAATAAGGAACTGATTCTCGAGAATCAGTTCCTTATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-3504s1c1
Sequence:CCGGGCCTGAAACTTTGATATGTATCTCGAGATACATATCAAAGTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022459.3-4266s1c1
Sequence:CCGGGCCATTTCATTGCCTTAATTTCTCGAGAAATTAAGGCAATGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022459.4-3715s21c1
Sequence:CCGGAGATTCTGAATGGTGATTTAACTCGAGTTAAATCACCATTCAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-304s21c1
Sequence:CCGGATCGAGTCTCTGCGAACATTCCTCGAGGAATGTTCGCAGAGACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-188s21c1
Sequence:CCGGTTGCAGTTTGCAAGCATATTTCTCGAGAAATATGCTTGCAAACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-1091s21c1
Sequence:CCGGTAACCGTGTTCCCACGAAATGCTCGAGCATTTCGTGGGAACACGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-2240s21c1
Sequence:CCGGGCCGAAGCCCACCTCTTAATTCTCGAGAATTAAGAGGTGGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022459
VALIDATED
XPO4 MISSION shRNA shRNA Plasmid DNA
exportin 4
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000165701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022459.3-2387s1c1
Sequence:CCGGCCCAGATTGACAACGTAGCAACTCGAGTTGCTACGTTGTCAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-2518s1c1
Sequence:CCGGGCACATAAACAGATATGCTATCTCGAGATAGCATATCTGTTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-2957s1c1
Sequence:CCGGCCCTAGAATTAGGAATGACATCTCGAGATGTCATTCCTAATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022459.3-1604s1c1
Sequence:CCGGCTCCGCTAATACCTCCAGAAACTCGAGTTTCTGGAGGTATTAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-6989s1c1
Sequence:CCGGCCAGAGAATAAGGAACTGATTCTCGAGAATCAGTTCCTTATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-3504s1c1
Sequence:CCGGGCCTGAAACTTTGATATGTATCTCGAGATACATATCAAAGTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022459.3-4266s1c1
Sequence:CCGGGCCATTTCATTGCCTTAATTTCTCGAGAAATTAAGGCAATGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022459.4-3715s21c1
Sequence:CCGGAGATTCTGAATGGTGATTTAACTCGAGTTAAATCACCATTCAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-304s21c1
Sequence:CCGGATCGAGTCTCTGCGAACATTCCTCGAGGAATGTTCGCAGAGACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-188s21c1
Sequence:CCGGTTGCAGTTTGCAAGCATATTTCTCGAGAAATATGCTTGCAAACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-1091s21c1
Sequence:CCGGTAACCGTGTTCCCACGAAATGCTCGAGCATTTCGTGGGAACACGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-2240s21c1
Sequence:CCGGGCCGAAGCCCACCTCTTAATTCTCGAGAATTAAGAGGTGGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022459
VALIDATED
XPO4 MISSION shRNA Lentiviral Transduction Particles
exportin 4
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000165701    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022459.3-2387s1c1
Sequence:CCGGCCCAGATTGACAACGTAGCAACTCGAGTTGCTACGTTGTCAATCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159748    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-2518s1c1
Sequence:CCGGGCACATAAACAGATATGCTATCTCGAGATAGCATATCTGTTTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159918    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-2957s1c1
Sequence:CCGGCCCTAGAATTAGGAATGACATCTCGAGATGTCATTCCTAATTCTAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164776    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022459.3-1604s1c1
Sequence:CCGGCTCCGCTAATACCTCCAGAAACTCGAGTTTCTGGAGGTATTAGCGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160271    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-6989s1c1
Sequence:CCGGCCAGAGAATAAGGAACTGATTCTCGAGAATCAGTTCCTTATTCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159557    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_022459.3-3504s1c1
Sequence:CCGGGCCTGAAACTTTGATATGTATCTCGAGATACATATCAAAGTTTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159095    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022459.3-4266s1c1
Sequence:CCGGGCCATTTCATTGCCTTAATTTCTCGAGAAATTAAGGCAATGAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429602    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022459.4-3715s21c1
Sequence:CCGGAGATTCTGAATGGTGATTTAACTCGAGTTAAATCACCATTCAGAATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-304s21c1
Sequence:CCGGATCGAGTCTCTGCGAACATTCCTCGAGGAATGTTCGCAGAGACTCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-188s21c1
Sequence:CCGGTTGCAGTTTGCAAGCATATTTCTCGAGAAATATGCTTGCAAACTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-1091s21c1
Sequence:CCGGTAACCGTGTTCCCACGAAATGCTCGAGCATTTCGTGGGAACACGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370130    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022459.4-2240s21c1
Sequence:CCGGGCCGAAGCCCACCTCTTAATTCTCGAGAATTAAGAGGTGGGCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks