EMAIL THIS PAGE TO A FRIEND

XPO5

exportin 5

Synonyms: exp5
Gene ID:
Human(57510) Summary: This gene encodes a member of the karyopherin family that is required for the transport of small RNAs and double-stranded RNA-binding proteins from the nucleus to the cytoplasm. The encoded protein translocates cargo through the nuclear pore complex in a RanGTP-dependent process. [provided by RefSeq, Aug 2011]
Mouse(72322) exportin 5
Rat(363194) exportin 5
cow(100139154) exportin 5
sheep(101115071) exportin 5
Zebrafish(558662) exportin 5
Horse(100067497) exportin 5
dog(474913) exportin 5
chicken(421450) exportin 5
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200003 Anti-Exportin 5 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB4200004 Anti-Exportin 5 (N-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
HPA018402 Anti-XPO5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
HPA023959 Anti-XPO5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution mouse, human, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2102725 Anti-XPO5 antibody produced in rabbit affinity isolated antibody guinea pig, human, mouse, horse, rat
western blot pricing
HPA029909 Anti-XPO5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab1 mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
HPA029910 Anti-XPO5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, ab2 human
immunohistochemistry pricing
SAB2103830 Anti-XPO5 antibody produced in rabbit affinity isolated antibody rat, mouse, rabbit, human, guinea pig, horse
western blot pricing
SAB2106784 Anti-XPO5 antibody produced in rabbit affinity isolated antibody human, rabbit, guinea pig, rat, horse
ELISA, western blot pricing
WH0057510M1 Monoclonal Anti-XPO5 antibody produced in mouse clone 2C5-1B3, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405214 Monoclonal Anti-XPO5 antibody produced in mouse clone 2C5-1B3, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020750 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020750 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020750 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028198 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028198 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028198 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020750 Rosetta Predictions human pricing
NM_001108789 Rosetta Predictions rat pricing
NM_028198 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020750 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00077558 predicted 673
2 SASI_Hs01_00077559 predicted 2204
3 SASI_Hs02_00353865 predicted 795
4 SASI_Hs01_00077561 predicted 2380
5 SASI_Hs02_00353866 predicted 767
6 SASI_Hs01_00077563 predicted 1607
7 SASI_Hs01_00077564 predicted 3516
8 SASI_Hs01_00077565 predicted 2467
9 SASI_Hs02_00353867 predicted 1051
10 SASI_Hs02_00353868 predicted 3133
11 SASI_Hs01_00077560 predicted 3446
12 SASI_Hs01_00077562 predicted 1640
13 SASI_Hs01_00077566 predicted 775
14 SASI_Hs01_00077567 predicted 1221
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108789 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242085 predicted 1108
2 SASI_Rn02_00242086 predicted 2397
3 SASI_Rn02_00242087 predicted 571
4 SASI_Rn02_00242088 predicted 2204
5 SASI_Rn02_00242089 predicted 3446
6 SASI_Rn02_00242090 predicted 1075
7 SASI_Rn02_00242091 predicted 677
8 SASI_Rn02_00242092 predicted 1225
9 SASI_Rn02_00242093 predicted 1321
10 SASI_Rn02_00242094 predicted 2381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028198 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00178339 predicted 1315
2 SASI_Mm01_00178340 predicted 2601
3 SASI_Mm01_00178341 predicted 2830
4 SASI_Mm01_00178342 predicted 1279
5 SASI_Mm01_00178343 predicted 1324
6 SASI_Mm01_00178344 predicted 2382
7 SASI_Mm01_00178345 predicted 2205
8 SASI_Mm01_00178346 predicted 1074
9 SASI_Mm02_00333507 predicted 1099
10 SASI_Mm02_00333508 predicted 2791
11 SASI_Mm01_00178347 predicted 1101
12 SASI_Mm01_00178348 predicted 681
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020750
VALIDATED
XPO5 MISSION shRNA Bacterial Glycerol Stock
exportin 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-3279s21c1
Sequence:CCGGATGTTTGTACAGCGCTATTAACTCGAGTTAATAGCGCTGTACAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-3654s21c1
Sequence:CCGGACCAATTCAAACGCCTCATTGCTCGAGCAATGAGGCGTTTGAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-2531s21c1
Sequence:CCGGGACAATTTGCTTGCGCTTATACTCGAGTATAAGCGCAAGCAAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-1088s21c1
Sequence:CCGGGATGTTGCCATGCATTATATACTCGAGTATATAATGCATGGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020750.1-282s1c1
Sequence:CCGGCGTTGTCAAGTTTCGGTGGAACTCGAGTTCCACCGAAACTTGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020750.1-3387s1c1
Sequence:CCGGCCTGGAGATAAGAGCTGTAATCTCGAGATTACAGCTCTTATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159427    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020750.1-4750s1c1
Sequence:CCGGGCAGAGTTAATCCATACAGAACTCGAGTTCTGTATGGATTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-2961s1c1
Sequence:CCGGCCGAGAAGTCATGGACCTAATCTCGAGATTAGGTCCATGACTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-1608s1c1
Sequence:CCGGCCAGATGTTTCGAACACTAAACTCGAGTTTAGTGTTCGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-819s1c1
Sequence:CCGGGATACTGTGTTTGCTGTTGAACTCGAGTTCAACAGCAAACACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020750
VALIDATED
XPO5 MISSION shRNA shRNA Plasmid DNA
exportin 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-3279s21c1
Sequence:CCGGATGTTTGTACAGCGCTATTAACTCGAGTTAATAGCGCTGTACAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-3654s21c1
Sequence:CCGGACCAATTCAAACGCCTCATTGCTCGAGCAATGAGGCGTTTGAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-2531s21c1
Sequence:CCGGGACAATTTGCTTGCGCTTATACTCGAGTATAAGCGCAAGCAAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-1088s21c1
Sequence:CCGGGATGTTGCCATGCATTATATACTCGAGTATATAATGCATGGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020750.1-282s1c1
Sequence:CCGGCGTTGTCAAGTTTCGGTGGAACTCGAGTTCCACCGAAACTTGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020750.1-3387s1c1
Sequence:CCGGCCTGGAGATAAGAGCTGTAATCTCGAGATTACAGCTCTTATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159427    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020750.1-4750s1c1
Sequence:CCGGGCAGAGTTAATCCATACAGAACTCGAGTTCTGTATGGATTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-2961s1c1
Sequence:CCGGCCGAGAAGTCATGGACCTAATCTCGAGATTAGGTCCATGACTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-1608s1c1
Sequence:CCGGCCAGATGTTTCGAACACTAAACTCGAGTTTAGTGTTCGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-819s1c1
Sequence:CCGGGATACTGTGTTTGCTGTTGAACTCGAGTTCAACAGCAAACACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020750
VALIDATED
XPO5 MISSION shRNA Lentiviral Transduction Particles
exportin 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-3279s21c1
Sequence:CCGGATGTTTGTACAGCGCTATTAACTCGAGTTAATAGCGCTGTACAAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-3654s21c1
Sequence:CCGGACCAATTCAAACGCCTCATTGCTCGAGCAATGAGGCGTTTGAATTGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420169    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-2531s21c1
Sequence:CCGGGACAATTTGCTTGCGCTTATACTCGAGTATAAGCGCAAGCAAATTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020750.2-1088s21c1
Sequence:CCGGGATGTTGCCATGCATTATATACTCGAGTATATAATGCATGGCAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020750.1-282s1c1
Sequence:CCGGCGTTGTCAAGTTTCGGTGGAACTCGAGTTCCACCGAAACTTGACAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162741    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020750.1-3387s1c1
Sequence:CCGGCCTGGAGATAAGAGCTGTAATCTCGAGATTACAGCTCTTATCTCCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159427    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020750.1-4750s1c1
Sequence:CCGGGCAGAGTTAATCCATACAGAACTCGAGTTCTGTATGGATTAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-2961s1c1
Sequence:CCGGCCGAGAAGTCATGGACCTAATCTCGAGATTAGGTCCATGACTTCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158915    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-1608s1c1
Sequence:CCGGCCAGATGTTTCGAACACTAAACTCGAGTTTAGTGTTCGAAACATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_020750.1-819s1c1
Sequence:CCGGGATACTGTGTTTGCTGTTGAACTCGAGTTCAACAGCAAACACAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028198
VALIDATED
XPO5 MISSION shRNA Bacterial Glycerol Stock
exportin 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-314s21c1
Sequence:CCGGCCCGATTGGAGAAGGTCTATCCTCGAGGATAGACCTTCTCCAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-1088s21c1
Sequence:CCGGCTAACATACAAACACCTATAACTCGAGTTATAGGTGTTTGTATGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-618s21c1
Sequence:CCGGGAACATGGAAAGAATCTTGAACTCGAGTTCAAGATTCTTTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-3507s21c1
Sequence:CCGGGGACCACTTCAAACGTCTAATCTCGAGATTAGACGTTTGAAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-3390s21c1
Sequence:CCGGCCTAGAGATAAGAGCAGTAATCTCGAGATTACTGCTCTTATCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-603s1c1
Sequence:CCGGGCAAACATTGACGCAGAACATCTCGAGATGTTCTGCGTCAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-618s1c1
Sequence:CCGGGAACATGGAAAGAATCTTGAACTCGAGTTCAAGATTCTTTCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-3390s1c1
Sequence:CCGGCCTAGAGATAAGAGCAGTAATCTCGAGATTACTGCTCTTATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-1345s1c1
Sequence:CCGGGATAGTGATGAGGACTTCAATCTCGAGATTGAAGTCCTCATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028198
VALIDATED
XPO5 MISSION shRNA shRNA Plasmid DNA
exportin 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-314s21c1
Sequence:CCGGCCCGATTGGAGAAGGTCTATCCTCGAGGATAGACCTTCTCCAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-1088s21c1
Sequence:CCGGCTAACATACAAACACCTATAACTCGAGTTATAGGTGTTTGTATGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-618s21c1
Sequence:CCGGGAACATGGAAAGAATCTTGAACTCGAGTTCAAGATTCTTTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-3507s21c1
Sequence:CCGGGGACCACTTCAAACGTCTAATCTCGAGATTAGACGTTTGAAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-3390s21c1
Sequence:CCGGCCTAGAGATAAGAGCAGTAATCTCGAGATTACTGCTCTTATCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-603s1c1
Sequence:CCGGGCAAACATTGACGCAGAACATCTCGAGATGTTCTGCGTCAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-618s1c1
Sequence:CCGGGAACATGGAAAGAATCTTGAACTCGAGTTCAAGATTCTTTCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-3390s1c1
Sequence:CCGGCCTAGAGATAAGAGCAGTAATCTCGAGATTACTGCTCTTATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-1345s1c1
Sequence:CCGGGATAGTGATGAGGACTTCAATCTCGAGATTGAAGTCCTCATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028198
VALIDATED
XPO5 MISSION shRNA Lentiviral Transduction Particles
exportin 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-314s21c1
Sequence:CCGGCCCGATTGGAGAAGGTCTATCCTCGAGGATAGACCTTCTCCAATCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375197    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-1088s21c1
Sequence:CCGGCTAACATACAAACACCTATAACTCGAGTTATAGGTGTTTGTATGTTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329007    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-618s21c1
Sequence:CCGGGAACATGGAAAGAATCTTGAACTCGAGTTCAAGATTCTTTCCATGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-3507s21c1
Sequence:CCGGGGACCACTTCAAACGTCTAATCTCGAGATTAGACGTTTGAAGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028198.2-3390s21c1
Sequence:CCGGCCTAGAGATAAGAGCAGTAATCTCGAGATTACTGCTCTTATCTCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201661    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-603s1c1
Sequence:CCGGGCAAACATTGACGCAGAACATCTCGAGATGTTCTGCGTCAATGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-618s1c1
Sequence:CCGGGAACATGGAAAGAATCTTGAACTCGAGTTCAAGATTCTTTCCATGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-3390s1c1
Sequence:CCGGCCTAGAGATAAGAGCAGTAATCTCGAGATTACTGCTCTTATCTCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028198.1-1345s1c1
Sequence:CCGGGATAGTGATGAGGACTTCAATCTCGAGATTGAAGTCCTCATCACTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks