EMAIL THIS PAGE TO A FRIEND

XPO6

exportin 6

Synonyms: EXP6 RANBP20
Gene ID:
Human(23214) Summary: The protein encoded by this gene is a member of the importin-beta family. Members of this family are regulated by the GTPase Ran to mediate transport of cargo across the nuclear envelope. This protein has been shown to mediate nuclear export of profilin-actin complexes. A pseudogene of this gene is located on the long arm of chromosome 14. Alternative splicing results in multiple transcript variants that encode different protein isoforms. [provided by RefSeq, Aug 2012]
Mouse(74204) exportin 6
Rat(293476) exportin 6
Zebrafish(333980) exportin 6
Horse(100064463) exportin 6
dog(479798) exportin 6
chicken(416410) exportin 6
cow(510797) exportin 6
sheep(101109933) exportin 6
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028816 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028816 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028816 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015171 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015171 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015171 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015171 Rosetta Predictions human pricing
NM_001011935 Rosetta Predictions rat pricing
XM_001076854 Rosetta Predictions rat pricing
XM_574559 Rosetta Predictions rat pricing
NM_028816 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015171 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145129 predicted 863
2 SASI_Hs02_00347173 predicted 579
3 SASI_Hs01_00145130 predicted 817
4 SASI_Hs01_00145131 predicted 2522
5 SASI_Hs01_00145133 predicted 3030
6 SASI_Hs02_00347174 predicted 1564
7 SASI_Hs01_00145134 predicted 2257
8 SASI_Hs01_00145135 predicted 1141
9 SASI_Hs02_00347175 predicted 664
10 SASI_Hs01_00145138 predicted 1775
11 SASI_Hs01_00145132 predicted 1749
12 SASI_Hs01_00145136 predicted 1996
13 SASI_Hs01_00145137 predicted 1134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011935 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199940 predicted 522
2 SASI_Rn02_00199941 predicted 3020
3 SASI_Rn02_00199942 predicted 2011
4 SASI_Rn02_00199943 predicted 756
5 SASI_Rn02_00199944 predicted 1772
6 SASI_Rn02_00199945 predicted 602
7 SASI_Rn02_00199946 predicted 572
8 SASI_Rn02_00199947 predicted 3496
9 SASI_Rn02_00199948 predicted 2819
10 SASI_Rn02_00199949 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076854 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00354803 predicted 677
2 SASI_Rn02_00354804 predicted 3184
3 SASI_Rn02_00354805 predicted 2167
4 SASI_Rn02_00354806 predicted 921
5 SASI_Rn02_00354807 predicted 1934
6 SASI_Rn02_00354808 predicted 760
7 SASI_Rn02_00354809 predicted 725
8 SASI_Rn02_00354810 predicted 3653
9 SASI_Rn02_00354811 predicted 2979
10 SASI_Rn02_00354812 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00402192 predicted 684
2 SASI_Rn02_00402193 predicted 914
3 SASI_Rn02_00402194 predicted 930
4 SASI_Rn02_00402195 predicted 868
5 SASI_Rn02_00402196 predicted 1160
6 SASI_Rn02_00402197 predicted 756
7 SASI_Rn02_00402198 predicted 732
8 SASI_Rn02_00402199 predicted 1234
9 SASI_Rn02_00402200 predicted 774
10 SASI_Rn02_00402201 predicted 1242
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028816 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128478 predicted 846
2 SASI_Mm01_00128479 predicted 2240
3 SASI_Mm01_00128480 predicted 2647
4 SASI_Mm01_00128481 predicted 777
5 SASI_Mm01_00128483 predicted 638
6 SASI_Mm01_00128484 predicted 585
7 SASI_Mm01_00128485 predicted 1150
8 SASI_Mm01_00128486 predicted 1772
9 SASI_Mm01_00128487 predicted 2845
10 SASI_Mm02_00334433 predicted 3616
11 SASI_Mm01_00128482 predicted 2231
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028816
XPO6 MISSION shRNA Bacterial Glycerol Stock
exportin 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000105441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-874s1c1
Sequence:CCGGCCCATGTTCTACCATGACTTTCTCGAGAAAGTCATGGTAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-873s1c1
Sequence:CCGGGCCCATGTTCTACCATGACTTCTCGAGAAGTCATGGTAGAACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-1596s1c1
Sequence:CCGGCGATGAGAGTTACATTGAGAACTCGAGTTCTCAATGTAACTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028816.2-4273s1c1
Sequence:CCGGGCCCAGGAGAAATTCGACATTCTCGAGAATGTCGAATTTCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-2044s1c1
Sequence:CCGGCCAGTTCTTCAGGACAATTTACTCGAGTAAATTGTCCTGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-874s21c1
Sequence:CCGGCCCATGTTCTACCATGACTTTCTCGAGAAAGTCATGGTAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-2044s21c1
Sequence:CCGGCCAGTTCTTCAGGACAATTTACTCGAGTAAATTGTCCTGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028816.2-4273s21c1
Sequence:CCGGGCCCAGGAGAAATTCGACATTCTCGAGAATGTCGAATTTCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-1596s21c1
Sequence:CCGGCGATGAGAGTTACATTGAGAACTCGAGTTCTCAATGTAACTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028816
XPO6 MISSION shRNA shRNA Plasmid DNA
exportin 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000105441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-874s1c1
Sequence:CCGGCCCATGTTCTACCATGACTTTCTCGAGAAAGTCATGGTAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-873s1c1
Sequence:CCGGGCCCATGTTCTACCATGACTTCTCGAGAAGTCATGGTAGAACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-1596s1c1
Sequence:CCGGCGATGAGAGTTACATTGAGAACTCGAGTTCTCAATGTAACTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028816.2-4273s1c1
Sequence:CCGGGCCCAGGAGAAATTCGACATTCTCGAGAATGTCGAATTTCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-2044s1c1
Sequence:CCGGCCAGTTCTTCAGGACAATTTACTCGAGTAAATTGTCCTGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-874s21c1
Sequence:CCGGCCCATGTTCTACCATGACTTTCTCGAGAAAGTCATGGTAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-2044s21c1
Sequence:CCGGCCAGTTCTTCAGGACAATTTACTCGAGTAAATTGTCCTGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028816.2-4273s21c1
Sequence:CCGGGCCCAGGAGAAATTCGACATTCTCGAGAATGTCGAATTTCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-1596s21c1
Sequence:CCGGCGATGAGAGTTACATTGAGAACTCGAGTTCTCAATGTAACTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028816
XPO6 MISSION shRNA Lentiviral Transduction Particles
exportin 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000105441    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-874s1c1
Sequence:CCGGCCCATGTTCTACCATGACTTTCTCGAGAAAGTCATGGTAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-873s1c1
Sequence:CCGGGCCCATGTTCTACCATGACTTCTCGAGAAGTCATGGTAGAACATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-1596s1c1
Sequence:CCGGCGATGAGAGTTACATTGAGAACTCGAGTTCTCAATGTAACTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105440    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028816.2-4273s1c1
Sequence:CCGGGCCCAGGAGAAATTCGACATTCTCGAGAATGTCGAATTTCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105442    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028816.2-2044s1c1
Sequence:CCGGCCAGTTCTTCAGGACAATTTACTCGAGTAAATTGTCCTGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-874s21c1
Sequence:CCGGCCCATGTTCTACCATGACTTTCTCGAGAAAGTCATGGTAGAACATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-2044s21c1
Sequence:CCGGCCAGTTCTTCAGGACAATTTACTCGAGTAAATTGTCCTGAAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324566    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028816.2-4273s21c1
Sequence:CCGGGCCCAGGAGAAATTCGACATTCTCGAGAATGTCGAATTTCTCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028816.2-1596s21c1
Sequence:CCGGCGATGAGAGTTACATTGAGAACTCGAGTTCTCAATGTAACTCTCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015171
VALIDATED
XPO6 MISSION shRNA Bacterial Glycerol Stock
exportin 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-2861s1c1
Sequence:CCGGCCATCACAACTGGAGGTACTTCTCGAGAAGTACCTCCAGTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-184s1c1
Sequence:CCGGGCACTAGGAATGACTATGTAACTCGAGTTACATAGTCATTCCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-1116s1c1
Sequence:CCGGGAGAGCTATATCGAGAAGTTTCTCGAGAAACTTCTCGATATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-2258s21c1
Sequence:CCGGTCGTGGAAAGGTTGGTCAAAGCTCGAGCTTTGACCAACCTTTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.2-1480s1c1
Sequence:CCGGATGGAATTTGAGGAGTATTTACTCGAGTAAATACTCCTCAAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015171.2-4126s1c1
Sequence:CCGGTACTAGGAGGCACCAGGAAATCTCGAGATTTCCTGGTGCCTCCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-1774s21c1
Sequence:CCGGTTGGACTATCTGACAAGTAAACTCGAGTTTACTTGTCAGATAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000365712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-1479s21c1
Sequence:CCGGTATGGAATTTGAGGAGTATTTCTCGAGAAATACTCCTCAAATTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-2909s21c1
Sequence:CCGGCCACCAAGTCTCGACAGATTTCTCGAGAAATCTGTCGAGACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015171
VALIDATED
XPO6 MISSION shRNA shRNA Plasmid DNA
exportin 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-2861s1c1
Sequence:CCGGCCATCACAACTGGAGGTACTTCTCGAGAAGTACCTCCAGTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-184s1c1
Sequence:CCGGGCACTAGGAATGACTATGTAACTCGAGTTACATAGTCATTCCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-1116s1c1
Sequence:CCGGGAGAGCTATATCGAGAAGTTTCTCGAGAAACTTCTCGATATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-2258s21c1
Sequence:CCGGTCGTGGAAAGGTTGGTCAAAGCTCGAGCTTTGACCAACCTTTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.2-1480s1c1
Sequence:CCGGATGGAATTTGAGGAGTATTTACTCGAGTAAATACTCCTCAAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015171.2-4126s1c1
Sequence:CCGGTACTAGGAGGCACCAGGAAATCTCGAGATTTCCTGGTGCCTCCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-1774s21c1
Sequence:CCGGTTGGACTATCTGACAAGTAAACTCGAGTTTACTTGTCAGATAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000365712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-1479s21c1
Sequence:CCGGTATGGAATTTGAGGAGTATTTCTCGAGAAATACTCCTCAAATTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-2909s21c1
Sequence:CCGGCCACCAAGTCTCGACAGATTTCTCGAGAAATCTGTCGAGACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015171
VALIDATED
XPO6 MISSION shRNA Lentiviral Transduction Particles
exportin 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-2861s1c1
Sequence:CCGGCCATCACAACTGGAGGTACTTCTCGAGAAGTACCTCCAGTTGTGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-184s1c1
Sequence:CCGGGCACTAGGAATGACTATGTAACTCGAGTTACATAGTCATTCCTAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147314    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.1-1116s1c1
Sequence:CCGGGAGAGCTATATCGAGAAGTTTCTCGAGAAACTTCTCGATATAGCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-2258s21c1
Sequence:CCGGTCGTGGAAAGGTTGGTCAAAGCTCGAGCTTTGACCAACCTTTCCACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015171.2-1480s1c1
Sequence:CCGGATGGAATTTGAGGAGTATTTACTCGAGTAAATACTCCTCAAATTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219864    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_015171.2-4126s1c1
Sequence:CCGGTACTAGGAGGCACCAGGAAATCTCGAGATTTCCTGGTGCCTCCTAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-1774s21c1
Sequence:CCGGTTGGACTATCTGACAAGTAAACTCGAGTTTACTTGTCAGATAGTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000365712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-1479s21c1
Sequence:CCGGTATGGAATTTGAGGAGTATTTCTCGAGAAATACTCCTCAAATTCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_015171.2-2909s21c1
Sequence:CCGGCCACCAAGTCTCGACAGATTTCTCGAGAAATCTGTCGAGACTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks