EMAIL THIS PAGE TO A FRIEND

XPO7

exportin 7

Synonyms: EXP7 RANBP16
UniProtKB ID: Q9UIA9, O94846, Q6PJK9, Q8NEK7
Gene ID:
Human(23039) Summary: The transport of protein and large RNAs through the nuclear pore complexes (NPC) is an energy-dependent and regulated process. The import of proteins with a nuclear localization signal (NLS) is accomplished by recognition of one or more clusters of basic amino acids by the importin-alpha/beta complex; see MIM 600685 and MIM 602738. The small GTPase RAN (MIM 601179) plays a key role in NLS-dependent protein import. RAN-binding protein-16 is a member of the importin-beta superfamily of nuclear transport receptors.[supplied by OMIM, Jul 2002]
Mouse(65246) exportin 7
Rat(361070) exportin 7
cow(100124498) exportin 7
sheep(101119366) exportin 7
Zebrafish(407710) exportin 7
Horse(100056362) exportin 7
dog(477387) exportin 7
chicken(426925) exportin 7
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015024 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015024 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015024 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023045 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023045 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023045 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100161 Rosetta Predictions human pricing
NM_001100162 Rosetta Predictions human pricing
NM_015024 Rosetta Predictions human pricing
NM_001108386 Rosetta Predictions rat pricing
NM_023045 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321734 predicted 875
2 SASI_Hs02_00321735 predicted 1155
3 SASI_Hs02_00321736 predicted 2397
4 SASI_Hs02_00321737 predicted 956
5 SASI_Hs02_00321738 predicted 331
6 SASI_Hs02_00321739 predicted 3125
7 SASI_Hs02_00321740 predicted 2561
8 SASI_Hs02_00321741 predicted 2248
9 SASI_Hs02_00321742 predicted 349
10 SASI_Hs02_00321743 predicted 2376
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100162 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321744 predicted 810
2 SASI_Hs02_00321745 predicted 1087
3 SASI_Hs02_00321746 predicted 2322
4 SASI_Hs02_00321747 predicted 890
5 SASI_Hs02_00321748 predicted 287
6 SASI_Hs02_00321749 predicted 3048
7 SASI_Hs02_00321750 predicted 2497
8 SASI_Hs02_00321751 predicted 2177
9 SASI_Hs02_00321752 predicted 300
10 SASI_Hs02_00321753 predicted 2302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00036136 predicted 849
2 SASI_Hs02_00346817 predicted 1130
3 SASI_Hs01_00036139 predicted 2371
4 SASI_Hs01_00036140 predicted 934
5 SASI_Hs01_00036141 predicted 333
6 SASI_Hs02_00346818 predicted 3092
7 SASI_Hs01_00036142 predicted 2541
8 SASI_Hs01_00036143 predicted 2216
9 SASI_Hs01_00036145 predicted 347
10 SASI_Hs02_00346819 predicted 2350
11 SASI_Hs01_00036137 predicted 541
12 SASI_Hs01_00036138 predicted 1206
13 SASI_Hs01_00036144 predicted 970
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108386 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00238149 predicted 230
2 SASI_Rn02_00238150 predicted 271
3 SASI_Rn02_00238151 predicted 312
4 SASI_Rn02_00238152 predicted 316
5 SASI_Rn02_00238153 predicted 296
6 SASI_Rn02_00238154 predicted 257
7 SASI_Rn02_00238155 predicted 267
8 SASI_Rn02_00238156 predicted 323
9 SASI_Rn02_00238157 predicted 251
10 SASI_Rn02_00238158 predicted 302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023045 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198035 predicted 2910
2 SASI_Mm02_00326739 predicted 3229
3 SASI_Mm02_00326740 predicted 3064
4 SASI_Mm02_00326741 predicted 2827
5 SASI_Mm01_00198037 predicted 1156
6 SASI_Mm01_00198038 predicted 1316
7 SASI_Mm01_00198034 predicted 1835
8 SASI_Mm01_00198039 predicted 2420
9 SASI_Mm01_00198040 predicted 427
10 SASI_Mm01_00198041 predicted 949
11 SASI_Mm01_00198036 predicted 251
12 SASI_Mm01_00198042 predicted 2452
13 SASI_Mm01_00198043 predicted 846
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015024
VALIDATED
XPO7 MISSION shRNA Bacterial Glycerol Stock
exportin 7
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-348s21c1
Sequence:CCGGGCGAATAGATATTCGGAACTACTCGAGTAGTTCCGAATATCTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-545s21c1
Sequence:CCGGGCATCATTGGTGTCACAATTTCTCGAGAAATTGTGACACCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-3339s21c1
Sequence:CCGGCGTGAATAGCAATGACATGATCTCGAGATCATGTCATTGCTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-1800s21c1
Sequence:CCGGGCAGAAATCCTCTAAGCTGTACTCGAGTACAGCTTAGAGGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015024.2-3489s1c1
Sequence:CCGGGCAAAGGTCAACTAGCTGCTTCTCGAGAAGCAGCTAGTTGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-544s1c1
Sequence:CCGGGCATCATTGGTGTCACAATTTCTCGAGAAATTGTGACACCAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-347s1c1
Sequence:CCGGGCGAATAGATATTCGGAACTACTCGAGTAGTTCCGAATATCTATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-3338s1c1
Sequence:CCGGCGTGAATAGCAATGACATGATCTCGAGATCATGTCATTGCTATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-1799s1c1
Sequence:CCGGGCAGAAATCCTCTAAGCTGTACTCGAGTACAGCTTAGAGGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-1947s1c1
Sequence:CCGGCTTCTCAATGACCTGTCCATTCTCGAGAATGGACAGGTCATTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015024
VALIDATED
XPO7 MISSION shRNA shRNA Plasmid DNA
exportin 7
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-348s21c1
Sequence:CCGGGCGAATAGATATTCGGAACTACTCGAGTAGTTCCGAATATCTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-545s21c1
Sequence:CCGGGCATCATTGGTGTCACAATTTCTCGAGAAATTGTGACACCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-3339s21c1
Sequence:CCGGCGTGAATAGCAATGACATGATCTCGAGATCATGTCATTGCTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-1800s21c1
Sequence:CCGGGCAGAAATCCTCTAAGCTGTACTCGAGTACAGCTTAGAGGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015024.2-3489s1c1
Sequence:CCGGGCAAAGGTCAACTAGCTGCTTCTCGAGAAGCAGCTAGTTGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-544s1c1
Sequence:CCGGGCATCATTGGTGTCACAATTTCTCGAGAAATTGTGACACCAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-347s1c1
Sequence:CCGGGCGAATAGATATTCGGAACTACTCGAGTAGTTCCGAATATCTATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-3338s1c1
Sequence:CCGGCGTGAATAGCAATGACATGATCTCGAGATCATGTCATTGCTATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-1799s1c1
Sequence:CCGGGCAGAAATCCTCTAAGCTGTACTCGAGTACAGCTTAGAGGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-1947s1c1
Sequence:CCGGCTTCTCAATGACCTGTCCATTCTCGAGAATGGACAGGTCATTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015024
VALIDATED
XPO7 MISSION shRNA Lentiviral Transduction Particles
exportin 7
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338891    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-348s21c1
Sequence:CCGGGCGAATAGATATTCGGAACTACTCGAGTAGTTCCGAATATCTATTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-545s21c1
Sequence:CCGGGCATCATTGGTGTCACAATTTCTCGAGAAATTGTGACACCAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338893    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-3339s21c1
Sequence:CCGGCGTGAATAGCAATGACATGATCTCGAGATCATGTCATTGCTATTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338892    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015024.4-1800s21c1
Sequence:CCGGGCAGAAATCCTCTAAGCTGTACTCGAGTACAGCTTAGAGGATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165236    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015024.2-3489s1c1
Sequence:CCGGGCAAAGGTCAACTAGCTGCTTCTCGAGAAGCAGCTAGTTGACCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159944    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-544s1c1
Sequence:CCGGGCATCATTGGTGTCACAATTTCTCGAGAAATTGTGACACCAATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158881    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-347s1c1
Sequence:CCGGGCGAATAGATATTCGGAACTACTCGAGTAGTTCCGAATATCTATTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158470    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-3338s1c1
Sequence:CCGGCGTGAATAGCAATGACATGATCTCGAGATCATGTCATTGCTATTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-1799s1c1
Sequence:CCGGGCAGAAATCCTCTAAGCTGTACTCGAGTACAGCTTAGAGGATTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162644    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_015024.2-1947s1c1
Sequence:CCGGCTTCTCAATGACCTGTCCATTCTCGAGAATGGACAGGTCATTGAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023045
VALIDATED
XPO7 MISSION shRNA Bacterial Glycerol Stock
exportin 7
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000324487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-3153s21c1
Sequence:CCGGCCTAAGAAACAGCATCGTCAACTCGAGTTGACGATGCTGTTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-1155s21c1
Sequence:CCGGCCCTGATGTTATCCGATTGATCTCGAGATCAATCGGATAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023045.2-4233s21c1
Sequence:CCGGCGACAGAGAATTGAGCCATTTCTCGAGAAATGGCTCAATTCTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-345s21c1
Sequence:CCGGGCGGATAGATATCCGGAACTACTCGAGTAGTTCCGGATATCTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023045.1-251s1c1
Sequence:CCGGGCGGATAGATATCCGGAACTACTCGAGTAGTTCCGGATATCTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-1061s1c1
Sequence:CCGGCCCTGATGTTATCCGATTGATCTCGAGATCAATCGGATAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-3059s1c1
Sequence:CCGGCCTAAGAAACAGCATCGTCAACTCGAGTTGACGATGCTGTTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023045.1-1626s1c1
Sequence:CCGGGCTGGTAATGAGAAGCTCGAACTCGAGTTCGAGCTTCTCATTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000105410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-4138s1c1
Sequence:CCGGCGACAGAGAATTGAGCCATTTCTCGAGAAATGGCTCAATTCTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023045
VALIDATED
XPO7 MISSION shRNA shRNA Plasmid DNA
exportin 7
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000324487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-3153s21c1
Sequence:CCGGCCTAAGAAACAGCATCGTCAACTCGAGTTGACGATGCTGTTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-1155s21c1
Sequence:CCGGCCCTGATGTTATCCGATTGATCTCGAGATCAATCGGATAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023045.2-4233s21c1
Sequence:CCGGCGACAGAGAATTGAGCCATTTCTCGAGAAATGGCTCAATTCTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-345s21c1
Sequence:CCGGGCGGATAGATATCCGGAACTACTCGAGTAGTTCCGGATATCTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023045.1-251s1c1
Sequence:CCGGGCGGATAGATATCCGGAACTACTCGAGTAGTTCCGGATATCTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-1061s1c1
Sequence:CCGGCCCTGATGTTATCCGATTGATCTCGAGATCAATCGGATAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-3059s1c1
Sequence:CCGGCCTAAGAAACAGCATCGTCAACTCGAGTTGACGATGCTGTTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023045.1-1626s1c1
Sequence:CCGGGCTGGTAATGAGAAGCTCGAACTCGAGTTCGAGCTTCTCATTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000105410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-4138s1c1
Sequence:CCGGCGACAGAGAATTGAGCCATTTCTCGAGAAATGGCTCAATTCTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023045
VALIDATED
XPO7 MISSION shRNA Lentiviral Transduction Particles
exportin 7
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000324487    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-3153s21c1
Sequence:CCGGCCTAAGAAACAGCATCGTCAACTCGAGTTGACGATGCTGTTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-1155s21c1
Sequence:CCGGCCCTGATGTTATCCGATTGATCTCGAGATCAATCGGATAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324563    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023045.2-4233s21c1
Sequence:CCGGCGACAGAGAATTGAGCCATTTCTCGAGAAATGGCTCAATTCTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023045.2-345s21c1
Sequence:CCGGGCGGATAGATATCCGGAACTACTCGAGTAGTTCCGGATATCTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105414    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023045.1-251s1c1
Sequence:CCGGGCGGATAGATATCCGGAACTACTCGAGTAGTTCCGGATATCTATCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105411    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-1061s1c1
Sequence:CCGGCCCTGATGTTATCCGATTGATCTCGAGATCAATCGGATAACATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105412    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-3059s1c1
Sequence:CCGGCCTAAGAAACAGCATCGTCAACTCGAGTTGACGATGCTGTTTCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105413    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023045.1-1626s1c1
Sequence:CCGGGCTGGTAATGAGAAGCTCGAACTCGAGTTCGAGCTTCTCATTACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000105410    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023045.1-4138s1c1
Sequence:CCGGCGACAGAGAATTGAGCCATTTCTCGAGAAATGGCTCAATTCTCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks