EMAIL THIS PAGE TO A FRIEND

XPOT

exportin, tRNA

Synonyms: XPO3
UniProtKB ID: O43592, A6NLH1, O43784, Q8WUG2, Q9BVS7
Gene ID:
Human(11260) Summary: This gene encodes a protein belonging to the RAN-GTPase exportin family that mediates export of tRNA from the nucleus to the cytoplasm. Translocation of tRNA to the cytoplasm occurs once exportin has bound both tRNA and GTP-bound RAN. [provided by RefSeq, Jul 2008]
Mouse(73192) exportin, tRNA (nuclear export receptor for tRNAs)
Rat(314879) exportin, tRNA
Zebrafish(558020) exportin, tRNA (nuclear export receptor for tRNAs)
chicken(417824) exportin, tRNA (nuclear export receptor for tRNAs)
dog(474427) exportin, tRNA
Horse(100051579) exportin, tRNA
domestic cat(101087416) exportin, tRNA
cow(535264) exportin, tRNA (nuclear export receptor for tRNAs)
sheep(101111086) exportin, tRNA
naked mole-rat(101712446) exportin, tRNA
105 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081056 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081056 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081056 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007235 Rosetta Predictions human pricing
NM_001108102 Rosetta Predictions rat pricing
NM_001081056 Rosetta Predictions mouse pricing
XM_125902 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182563 predicted 1322
2 SASI_Hs02_00343240 predicted 3325
3 SASI_Hs01_00182565 predicted 2535
4 SASI_Hs01_00182566 predicted 2518
5 SASI_Hs02_00343241 predicted 443
6 SASI_Hs01_00182568 predicted 1977
7 SASI_Hs01_00182569 predicted 1823
8 SASI_Hs01_00182570 predicted 1317
9 SASI_Hs01_00182571 predicted 1537
10 SASI_Hs02_00343242 predicted 1230
11 SASI_Hs01_00182564 predicted 468
12 SASI_Hs01_00182567 predicted 3106
13 SASI_Hs01_00182572 predicted 1079
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108102 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00235374 predicted 1995
2 SASI_Rn02_00235375 predicted 2238
3 SASI_Rn02_00235376 predicted 2539
4 SASI_Rn02_00235377 predicted 1225
5 SASI_Rn02_00235378 predicted 327
6 SASI_Rn02_00235379 predicted 2004
7 SASI_Rn02_00235380 predicted 964
8 SASI_Rn02_00235381 predicted 1431
9 SASI_Rn02_00235382 predicted 939
10 SASI_Rn02_00235383 predicted 425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081056 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294741 predicted 1009
2 SASI_Mm02_00294742 predicted 2884
3 SASI_Mm02_00294743 predicted 1194
4 SASI_Mm02_00294744 predicted 2787
5 SASI_Mm02_00294745 predicted 1609
6 SASI_Mm02_00294746 predicted 2492
7 SASI_Mm02_00294747 predicted 928
8 SASI_Mm02_00294748 predicted 316
9 SASI_Mm02_00294749 predicted 2956
10 SASI_Mm02_00294750 predicted 1399
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125902 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00236598 predicted 1017
2 SASI_Mm01_00236599 predicted 2883
3 SASI_Mm01_00236600 predicted 2281
4 SASI_Mm01_00236601 predicted 1192
5 SASI_Mm01_00236602 predicted 2792
6 SASI_Mm01_00236603 predicted 1608
7 SASI_Mm01_00236604 predicted 2494
8 SASI_Mm01_00236605 predicted 933
9 SASI_Mm01_00236606 predicted 322
10 SASI_Mm01_00236607 predicted 2166
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007235
VALIDATED
XPOT MISSION shRNA Bacterial Glycerol Stock
exportin, tRNA
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-919s1c1
Sequence:CCGGGCTCGTAGGAATACTCTCATACTCGAGTATGAGAGTATTCCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-2808s1c1
Sequence:CCGGGCGGAGGAGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007235.3-3097s1c1
Sequence:CCGGGCACAAACAGTATTGGCTTTACTCGAGTAAAGCCAATACTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-463s1c1
Sequence:CCGGGCTGATTCAGACTTTAGACAACTCGAGTTGTCTAAAGTCTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007235.3-1672s1c1
Sequence:CCGGGCTCAAGTTTCACCAGAGTTACTCGAGTAACTCTGGTGAAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-2808s21c1
Sequence:CCGGGCGGAGGAGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-3097s21c1
Sequence:CCGGGCACAAACAGTATTGGCTTTACTCGAGTAAAGCCAATACTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-463s21c1
Sequence:CCGGGCTGATTCAGACTTTAGACAACTCGAGTTGTCTAAAGTCTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-919s21c1
Sequence:CCGGGCTCGTAGGAATACTCTCATACTCGAGTATGAGAGTATTCCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-1672s21c1
Sequence:CCGGGCTCAAGTTTCACCAGAGTTACTCGAGTAACTCTGGTGAAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007235
VALIDATED
XPOT MISSION shRNA shRNA Plasmid DNA
exportin, tRNA
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-919s1c1
Sequence:CCGGGCTCGTAGGAATACTCTCATACTCGAGTATGAGAGTATTCCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-2808s1c1
Sequence:CCGGGCGGAGGAGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007235.3-3097s1c1
Sequence:CCGGGCACAAACAGTATTGGCTTTACTCGAGTAAAGCCAATACTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-463s1c1
Sequence:CCGGGCTGATTCAGACTTTAGACAACTCGAGTTGTCTAAAGTCTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007235.3-1672s1c1
Sequence:CCGGGCTCAAGTTTCACCAGAGTTACTCGAGTAACTCTGGTGAAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-2808s21c1
Sequence:CCGGGCGGAGGAGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-3097s21c1
Sequence:CCGGGCACAAACAGTATTGGCTTTACTCGAGTAAAGCCAATACTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-463s21c1
Sequence:CCGGGCTGATTCAGACTTTAGACAACTCGAGTTGTCTAAAGTCTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-919s21c1
Sequence:CCGGGCTCGTAGGAATACTCTCATACTCGAGTATGAGAGTATTCCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-1672s21c1
Sequence:CCGGGCTCAAGTTTCACCAGAGTTACTCGAGTAACTCTGGTGAAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007235
VALIDATED
XPOT MISSION shRNA Lentiviral Transduction Particles
exportin, tRNA
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059898    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-919s1c1
Sequence:CCGGGCTCGTAGGAATACTCTCATACTCGAGTATGAGAGTATTCCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059902    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-2808s1c1
Sequence:CCGGGCGGAGGAGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_007235.3-3097s1c1
Sequence:CCGGGCACAAACAGTATTGGCTTTACTCGAGTAAAGCCAATACTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_007235.3-463s1c1
Sequence:CCGGGCTGATTCAGACTTTAGACAACTCGAGTTGTCTAAAGTCTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_007235.3-1672s1c1
Sequence:CCGGGCTCAAGTTTCACCAGAGTTACTCGAGTAACTCTGGTGAAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-2808s21c1
Sequence:CCGGGCGGAGGAGTTACTTTGCTTTCTCGAGAAAGCAAAGTAACTCCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-3097s21c1
Sequence:CCGGGCACAAACAGTATTGGCTTTACTCGAGTAAAGCCAATACTGTTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300799    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-463s21c1
Sequence:CCGGGCTGATTCAGACTTTAGACAACTCGAGTTGTCTAAAGTCTGAATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-919s21c1
Sequence:CCGGGCTCGTAGGAATACTCTCATACTCGAGTATGAGAGTATTCCTACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007235.3-1672s21c1
Sequence:CCGGGCTCAAGTTTCACCAGAGTTACTCGAGTAACTCTGGTGAAACTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081056
VALIDATED
XPOT MISSION shRNA Bacterial Glycerol Stock
exportin, tRNA
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000251563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3386s21c1
Sequence:CCGGTTGCCTGCATGCCGGTTTAAACTCGAGTTTAAACCGGCATGCAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-2951s21c1
Sequence:CCGGGCAGATGCACAGACAGTATTGCTCGAGCAATACTGTCTGTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3066s21c1
Sequence:CCGGTACAAGTTGCTCCAGAAATAACTCGAGTTATTTCTGGAGCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3107s21c1
Sequence:CCGGCTTCAGCAGCCTGATGCTAAACTCGAGTTTAGCATCAGGCTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3035s21c1
Sequence:CCGGCAGTATCTTCAACAAGAATATCTCGAGATATTCTTGTTGAAGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081056
VALIDATED
XPOT MISSION shRNA shRNA Plasmid DNA
exportin, tRNA
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000251563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3386s21c1
Sequence:CCGGTTGCCTGCATGCCGGTTTAAACTCGAGTTTAAACCGGCATGCAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-2951s21c1
Sequence:CCGGGCAGATGCACAGACAGTATTGCTCGAGCAATACTGTCTGTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3066s21c1
Sequence:CCGGTACAAGTTGCTCCAGAAATAACTCGAGTTATTTCTGGAGCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3107s21c1
Sequence:CCGGCTTCAGCAGCCTGATGCTAAACTCGAGTTTAGCATCAGGCTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3035s21c1
Sequence:CCGGCAGTATCTTCAACAAGAATATCTCGAGATATTCTTGTTGAAGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081056
VALIDATED
XPOT MISSION shRNA Lentiviral Transduction Particles
exportin, tRNA
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000251563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3386s21c1
Sequence:CCGGTTGCCTGCATGCCGGTTTAAACTCGAGTTTAAACCGGCATGCAGGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-2951s21c1
Sequence:CCGGGCAGATGCACAGACAGTATTGCTCGAGCAATACTGTCTGTGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3066s21c1
Sequence:CCGGTACAAGTTGCTCCAGAAATAACTCGAGTTATTTCTGGAGCAACTTGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3107s21c1
Sequence:CCGGCTTCAGCAGCCTGATGCTAAACTCGAGTTTAGCATCAGGCTGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251561    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001081056.1-3035s21c1
Sequence:CCGGCAGTATCTTCAACAAGAATATCTCGAGATATTCTTGTTGAAGATACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks