EMAIL THIS PAGE TO A FRIEND

XPR1

xenotropic and polytropic retrovirus receptor 1

Synonyms: SYG1 X3
UniProtKB ID: Q9UBH6, O95719, Q7L8K9, Q8IW20, Q9NT19, Q9UFB9
Gene ID:
Mouse(19775) xenotropic and polytropic retrovirus receptor 1
Rat(289424) xenotropic and polytropic retrovirus receptor 1
chicken(424415) xenotropic and polytropic retrovirus receptor 1
dog(490301) xenotropic and polytropic retrovirus receptor 1
domestic cat(100505400) xenotropic and polytropic retrovirus receptor 1
Domestic Rabbit(100339244) xenotropic and polytropic retrovirus receptor 1
naked mole-rat(101696518) xenotropic and polytropic retrovirus receptor 1
domestic guinea pig(100725139) xenotropic and polytropic retrovirus receptor 1
cow(536550) xenotropic and polytropic retrovirus receptor 1
sheep(101123394) xenotropic and polytropic retrovirus receptor 1
218 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004736 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004736 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004736 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011273 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011273 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011273 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004736 Rosetta Predictions human pricing
NM_001105992 Rosetta Predictions rat pricing
NM_011273 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004736 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00338216 predicted 582
2 SASI_Hs01_00073363 predicted 1724
3 SASI_Hs01_00073364 predicted 1519
4 SASI_Hs02_00338217 predicted 1827
5 SASI_Hs01_00073365 predicted 601
6 SASI_Hs01_00073366 predicted 1313
7 SASI_Hs01_00073368 predicted 1968
8 SASI_Hs01_00073369 predicted 1353
9 SASI_Hs01_00073370 predicted 1330
10 SASI_Hs02_00338218 predicted 1049
11 SASI_Hs01_00073361 predicted 885
12 SASI_Hs01_00073362 predicted 1604
13 SASI_Hs01_00073367 predicted 1421
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105992 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00214562 predicted 1567
2 SASI_Rn02_00214563 predicted 223
3 SASI_Rn02_00214564 predicted 2133
4 SASI_Rn02_00214565 predicted 1660
5 SASI_Rn02_00214566 predicted 963
6 SASI_Rn02_00214567 predicted 1591
7 SASI_Rn02_00214568 predicted 524
8 SASI_Rn02_00214569 predicted 1291
9 SASI_Rn02_00214570 predicted 216
10 SASI_Rn02_00214571 predicted 1901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011273 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078525 predicted 1643
2 SASI_Mm01_00078526 predicted 516
3 SASI_Mm01_00078527 predicted 1689
4 SASI_Mm02_00320305 predicted 334
5 SASI_Mm01_00078528 predicted 1768
6 SASI_Mm01_00078529 predicted 1076
7 SASI_Mm01_00078530 predicted 577
8 SASI_Mm01_00078531 predicted 1534
9 SASI_Mm01_00078532 predicted 638
10 SASI_Mm01_00078533 predicted 2012
11 SASI_Mm01_00078534 predicted 1906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004736
XPR1 MISSION shRNA Bacterial Glycerol Stock
xenotropic and polytropic retrovirus receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000358250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-1317s21c1
Sequence:CCGGTAAACTGCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-942s21c1
Sequence:CCGGCCTTGTGCTTGCCGCTGTATTCTCGAGAATACAGCGGCAAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-1865s21c1
Sequence:CCGGACTACTACTGTGCCATAATAGCTCGAGCTATTATGGCACAGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004736.2-4025s1c1
Sequence:CCGGCCCTGTCGTAACTCCAGTAAACTCGAGTTTACTGGAGTTACGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-2206s1c1
Sequence:CCGGCGTGACACTAAGGTATTGATACTCGAGTATCAATACCTTAGTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-925s1c1
Sequence:CCGGGCCGCTGTATTTAAACTTGAACTCGAGTTCAAGTTTAAATACAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-1974s1c1
Sequence:CCGGGCGATTTGTGTGGAACTTCTTCTCGAGAAGAAGTTCCACACAAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-1849s1c1
Sequence:CCGGGCCATAATAGAGGATGTGATTCTCGAGAATCACATCCTCTATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004736
XPR1 MISSION shRNA shRNA Plasmid DNA
xenotropic and polytropic retrovirus receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000358250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-1317s21c1
Sequence:CCGGTAAACTGCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-942s21c1
Sequence:CCGGCCTTGTGCTTGCCGCTGTATTCTCGAGAATACAGCGGCAAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-1865s21c1
Sequence:CCGGACTACTACTGTGCCATAATAGCTCGAGCTATTATGGCACAGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004736.2-4025s1c1
Sequence:CCGGCCCTGTCGTAACTCCAGTAAACTCGAGTTTACTGGAGTTACGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-2206s1c1
Sequence:CCGGCGTGACACTAAGGTATTGATACTCGAGTATCAATACCTTAGTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-925s1c1
Sequence:CCGGGCCGCTGTATTTAAACTTGAACTCGAGTTCAAGTTTAAATACAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-1974s1c1
Sequence:CCGGGCGATTTGTGTGGAACTTCTTCTCGAGAAGAAGTTCCACACAAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-1849s1c1
Sequence:CCGGGCCATAATAGAGGATGTGATTCTCGAGAATCACATCCTCTATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004736
XPR1 MISSION shRNA Lentiviral Transduction Particles
xenotropic and polytropic retrovirus receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000358250    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-1317s21c1
Sequence:CCGGTAAACTGCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGCAGTTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-942s21c1
Sequence:CCGGCCTTGTGCTTGCCGCTGTATTCTCGAGAATACAGCGGCAAGCACAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358252    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004736.3-1865s21c1
Sequence:CCGGACTACTACTGTGCCATAATAGCTCGAGCTATTATGGCACAGTAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014298    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004736.2-4025s1c1
Sequence:CCGGCCCTGTCGTAACTCCAGTAAACTCGAGTTTACTGGAGTTACGACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014300    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-2206s1c1
Sequence:CCGGCGTGACACTAAGGTATTGATACTCGAGTATCAATACCTTAGTGTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014301    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-925s1c1
Sequence:CCGGGCCGCTGTATTTAAACTTGAACTCGAGTTCAAGTTTAAATACAGCGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014302    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-1974s1c1
Sequence:CCGGGCGATTTGTGTGGAACTTCTTCTCGAGAAGAAGTTCCACACAAATCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014299    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004736.2-1849s1c1
Sequence:CCGGGCCATAATAGAGGATGTGATTCTCGAGAATCACATCCTCTATTATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011273
XPR1 MISSION shRNA Bacterial Glycerol Stock
xenotropic and polytropic retrovirus receptor 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.2-1335s1c1
Sequence:CCGGCAAACTTCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011273.2-4714s1c1
Sequence:CCGGCAGTAAGTGATGGAGTATATTCTCGAGAATATACTCCATCACTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011273.2-5844s1c1
Sequence:CCGGGATTATACTATTGCGTAAATGCTCGAGCATTTACGCAATAGTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-2245s21c1
Sequence:CCGGGCTCGCGACACTAAGGTATTGCTCGAGCAATACCTTAGTGTCGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011273.2-6592s21c1
Sequence:CCGGATAGCAAACCTTCGGTTTATTCTCGAGAATAAACCGAAGGTTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-1941s21c1
Sequence:CCGGCTCTATTACTGCTACGTTTAACTCGAGTTAAACGTAGCAGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-526s21c1
Sequence:CCGGACATTGCGACAGCGCAGAAAGCTCGAGCTTTCTGCGCTGTCGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000240644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-1253s21c1
Sequence:CCGGCACTAGCCCTTTATGGGTTTACTCGAGTAAACCCATAAAGGGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-696s1c1
Sequence:CCGGGTGGTCACCAATGAACTTGAACTCGAGTTCAAGTTCATTGGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-165s1c1
Sequence:CCGGGCATTCAAGGATATGCTGTATCTCGAGATACAGCATATCCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-1014s1c1
Sequence:CCGGCCAAGAAACAATTTGTCTCATCTCGAGATGAGACAAATTGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011273
XPR1 MISSION shRNA shRNA Plasmid DNA
xenotropic and polytropic retrovirus receptor 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.2-1335s1c1
Sequence:CCGGCAAACTTCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011273.2-4714s1c1
Sequence:CCGGCAGTAAGTGATGGAGTATATTCTCGAGAATATACTCCATCACTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011273.2-5844s1c1
Sequence:CCGGGATTATACTATTGCGTAAATGCTCGAGCATTTACGCAATAGTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-2245s21c1
Sequence:CCGGGCTCGCGACACTAAGGTATTGCTCGAGCAATACCTTAGTGTCGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011273.2-6592s21c1
Sequence:CCGGATAGCAAACCTTCGGTTTATTCTCGAGAATAAACCGAAGGTTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-1941s21c1
Sequence:CCGGCTCTATTACTGCTACGTTTAACTCGAGTTAAACGTAGCAGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-526s21c1
Sequence:CCGGACATTGCGACAGCGCAGAAAGCTCGAGCTTTCTGCGCTGTCGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000240644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-1253s21c1
Sequence:CCGGCACTAGCCCTTTATGGGTTTACTCGAGTAAACCCATAAAGGGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-696s1c1
Sequence:CCGGGTGGTCACCAATGAACTTGAACTCGAGTTCAAGTTCATTGGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-165s1c1
Sequence:CCGGGCATTCAAGGATATGCTGTATCTCGAGATACAGCATATCCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-1014s1c1
Sequence:CCGGCCAAGAAACAATTTGTCTCATCTCGAGATGAGACAAATTGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011273
XPR1 MISSION shRNA Lentiviral Transduction Particles
xenotropic and polytropic retrovirus receptor 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215357    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.2-1335s1c1
Sequence:CCGGCAAACTTCTGTTTCGAGTATTCTCGAGAATACTCGAAACAGAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216204    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011273.2-4714s1c1
Sequence:CCGGCAGTAAGTGATGGAGTATATTCTCGAGAATATACTCCATCACTTACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216364    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011273.2-5844s1c1
Sequence:CCGGGATTATACTATTGCGTAAATGCTCGAGCATTTACGCAATAGTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-2245s21c1
Sequence:CCGGGCTCGCGACACTAAGGTATTGCTCGAGCAATACCTTAGTGTCGCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240647    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011273.2-6592s21c1
Sequence:CCGGATAGCAAACCTTCGGTTTATTCTCGAGAATAAACCGAAGGTTTGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-1941s21c1
Sequence:CCGGCTCTATTACTGCTACGTTTAACTCGAGTTAAACGTAGCAGTAATAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-526s21c1
Sequence:CCGGACATTGCGACAGCGCAGAAAGCTCGAGCTTTCTGCGCTGTCGCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000240644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011273.2-1253s21c1
Sequence:CCGGCACTAGCCCTTTATGGGTTTACTCGAGTAAACCCATAAAGGGCTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193965    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-696s1c1
Sequence:CCGGGTGGTCACCAATGAACTTGAACTCGAGTTCAAGTTCATTGGTGACCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-165s1c1
Sequence:CCGGGCATTCAAGGATATGCTGTATCTCGAGATACAGCATATCCTTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174417    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_011273.1-1014s1c1
Sequence:CCGGCCAAGAAACAATTTGTCTCATCTCGAGATGAGACAAATTGTTTCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks