EMAIL THIS PAGE TO A FRIEND

XRCC1

X-ray repair complementing defective repair in Chinese hamster cells 1

Synonyms: RCC
UniProtKB ID: P18887, Q6IBS4, Q9HCB1
Gene ID:
Human(7515) Summary: The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
Mouse(22594) X-ray repair complementing defective repair in Chinese hamster cells 1
Rat(84495) X-ray repair complementing defective repair in Chinese hamster cells 1
cow(616905) X-ray repair complementing defective repair in Chinese hamster cells 1
sheep(101106279) X-ray repair complementing defective repair in Chinese hamster cells 1
domestic guinea pig(100727471) X-ray repair complementing defective repair in Chinese hamster cells 1
naked mole-rat(101701146) X-ray repair complementing defective repair in Chinese hamster cells 1
fruit fly(31451) CG4208 gene product from transcript CG4208-RA
Zebrafish(445480) X-ray repair complementing defective repair in Chinese hamster cells 1
dog(476447) X-ray repair complementing defective repair in Chinese hamster cells 1
Horse(100070201) X-ray repair complementing defective repair in Chinese hamster cells 1
domestic cat(101091917) X-ray repair complementing defective repair in Chinese hamster cells 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009532 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009532 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009532 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006297 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006297 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006297 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006297 Rosetta Predictions human pricing
NM_053435 Rosetta Predictions rat pricing
NM_009532 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006297 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00341302 predicted 1486
2 SASI_Hs01_00037369 predicted 1733
3 SASI_Hs01_00037370 predicted 1787
4 SASI_Hs02_00341303 predicted 1479
5 SASI_Hs01_00037374 predicted 274
6 SASI_Hs01_00037375 predicted 633
7 SASI_Hs01_00037378 predicted 225
8 SASI_Hs02_00341304 predicted 270
9 SASI_Hs02_00341305 predicted 1205
10 SASI_Hs02_00341306 predicted 206
11 SASI_Hs01_00037371 predicted 273
12 SASI_Hs01_00037372 predicted 371
13 SASI_Hs01_00037373 predicted 1521
14 SASI_Hs01_00037376 predicted 276
15 SASI_Hs01_00037377 predicted 1720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053435 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00266003 predicted 1688
2 SASI_Rn01_00113271 predicted 1754
3 SASI_Rn01_00113273 predicted 1460
4 SASI_Rn01_00113274 predicted 820
5 SASI_Rn01_00113276 predicted 1209
6 SASI_Rn01_00113277 predicted 419
7 SASI_Rn01_00113278 predicted 814
8 SASI_Rn01_00113279 predicted 1836
9 SASI_Rn01_00113280 predicted 1490
10 SASI_Rn02_00266004 predicted 599
11 SASI_Rn01_00113272 predicted 1156
12 SASI_Rn01_00113275 predicted 821
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009532 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316340 predicted 751
2 SASI_Mm02_00316341 predicted 970
3 SASI_Mm02_00316342 predicted 727
4 SASI_Mm02_00316343 predicted 917
5 SASI_Mm02_00316344 predicted 340
6 SASI_Mm02_00316345 predicted 1849
7 SASI_Mm02_00316346 predicted 960
8 SASI_Mm02_00316347 predicted 681
9 SASI_Mm02_00316348 predicted 220
10 SASI_Mm02_00316349 predicted 906
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009532
XRCC1 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-1930s1c1
Sequence:CCGGCCAGGACAATAGTGACACTGACTCGAGTCAGTGTCACTATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-707s1c1
Sequence:CCGGCACAGTGTGGACATTGGCAATCTCGAGATTGCCAATGTCCACACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-2363s1c1
Sequence:CCGGCGGTGGATCTACAGTTGTAATCTCGAGATTACAACTGTAGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-1548s21c1
Sequence:CCGGCCAGGACAATAGTGACACTGACTCGAGTCAGTGTCACTATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-963s21c1
Sequence:CCGGCACCCTCAAGAGACCCAAATTCTCGAGAATTTGGGTCTCTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-325s21c1
Sequence:CCGGCACAGTGTGGACATTGGCAATCTCGAGATTGCCAATGTCCACACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-1981s21c1
Sequence:CCGGCGGTGGATCTACAGTTGTAATCTCGAGATTACAACTGTAGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-1345s1c2
Sequence:CCGGCACCCTCAAGAGACCCAAATTCTCGAGAATTTGGGTCTCTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009532
XRCC1 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-1930s1c1
Sequence:CCGGCCAGGACAATAGTGACACTGACTCGAGTCAGTGTCACTATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-707s1c1
Sequence:CCGGCACAGTGTGGACATTGGCAATCTCGAGATTGCCAATGTCCACACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-2363s1c1
Sequence:CCGGCGGTGGATCTACAGTTGTAATCTCGAGATTACAACTGTAGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-1548s21c1
Sequence:CCGGCCAGGACAATAGTGACACTGACTCGAGTCAGTGTCACTATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-963s21c1
Sequence:CCGGCACCCTCAAGAGACCCAAATTCTCGAGAATTTGGGTCTCTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-325s21c1
Sequence:CCGGCACAGTGTGGACATTGGCAATCTCGAGATTGCCAATGTCCACACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-1981s21c1
Sequence:CCGGCGGTGGATCTACAGTTGTAATCTCGAGATTACAACTGTAGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-1345s1c2
Sequence:CCGGCACCCTCAAGAGACCCAAATTCTCGAGAATTTGGGTCTCTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009532
XRCC1 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-1930s1c1
Sequence:CCGGCCAGGACAATAGTGACACTGACTCGAGTCAGTGTCACTATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-707s1c1
Sequence:CCGGCACAGTGTGGACATTGGCAATCTCGAGATTGCCAATGTCCACACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077238    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-2363s1c1
Sequence:CCGGCGGTGGATCTACAGTTGTAATCTCGAGATTACAACTGTAGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301394    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-1548s21c1
Sequence:CCGGCCAGGACAATAGTGACACTGACTCGAGTCAGTGTCACTATTGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-963s21c1
Sequence:CCGGCACCCTCAAGAGACCCAAATTCTCGAGAATTTGGGTCTCTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301397    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-325s21c1
Sequence:CCGGCACAGTGTGGACATTGGCAATCTCGAGATTGCCAATGTCCACACTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301396    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009532.4-1981s21c1
Sequence:CCGGCGGTGGATCTACAGTTGTAATCTCGAGATTACAACTGTAGATCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222627    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009532.2-1345s1c2
Sequence:CCGGCACCCTCAAGAGACCCAAATTCTCGAGAATTTGGGTCTCTTGAGGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006297
VALIDATED
XRCC1 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000011210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1933s1c1
Sequence:CCGGCGATGGATCTACAGTTGCAATCTCGAGATTGCAACTGTAGATCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1795s1c1
Sequence:CCGGCGATACGTCACAGCCTTCAATCTCGAGATTGAAGGCTGTGACGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006297.1-363s1c1
Sequence:CCGGCCTTCTGGTCACCTCATCTTTCTCGAGAAAGATGAGGTGACCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006297.1-920s1c1
Sequence:CCGGGACCTAAATTGCCAGCTCCAACTCGAGTTGGAGCTGGCAATTTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1489s1c1
Sequence:CCGGCCAGTGCTCCAGGAAGATATACTCGAGTATATCTTCCTGGAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006297.2-1504s21c1
Sequence:CCGGCCAGTGCTCCAGGAAGATATACTCGAGTATATCTTCCTGGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1748s21c1
Sequence:CCGGTCCAGGGCAAGCACTTCTTTCCTCGAGGAAAGAAGTGCTTGCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1541s21c1
Sequence:CCGGAGTCAGAAGGACAGGACAATGCTCGAGCATTGTCCTGTCCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000273634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1810s21c1
Sequence:CCGGCGATACGTCACAGCCTTCAATCTCGAGATTGAAGGCTGTGACGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006297
VALIDATED
XRCC1 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000011210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1933s1c1
Sequence:CCGGCGATGGATCTACAGTTGCAATCTCGAGATTGCAACTGTAGATCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1795s1c1
Sequence:CCGGCGATACGTCACAGCCTTCAATCTCGAGATTGAAGGCTGTGACGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006297.1-363s1c1
Sequence:CCGGCCTTCTGGTCACCTCATCTTTCTCGAGAAAGATGAGGTGACCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006297.1-920s1c1
Sequence:CCGGGACCTAAATTGCCAGCTCCAACTCGAGTTGGAGCTGGCAATTTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1489s1c1
Sequence:CCGGCCAGTGCTCCAGGAAGATATACTCGAGTATATCTTCCTGGAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006297.2-1504s21c1
Sequence:CCGGCCAGTGCTCCAGGAAGATATACTCGAGTATATCTTCCTGGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1748s21c1
Sequence:CCGGTCCAGGGCAAGCACTTCTTTCCTCGAGGAAAGAAGTGCTTGCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1541s21c1
Sequence:CCGGAGTCAGAAGGACAGGACAATGCTCGAGCATTGTCCTGTCCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000273634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1810s21c1
Sequence:CCGGCGATACGTCACAGCCTTCAATCTCGAGATTGAAGGCTGTGACGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006297
VALIDATED
XRCC1 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000011210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1933s1c1
Sequence:CCGGCGATGGATCTACAGTTGCAATCTCGAGATTGCAACTGTAGATCCATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1795s1c1
Sequence:CCGGCGATACGTCACAGCCTTCAATCTCGAGATTGAAGGCTGTGACGTATCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006297.1-363s1c1
Sequence:CCGGCCTTCTGGTCACCTCATCTTTCTCGAGAAAGATGAGGTGACCAGAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006297.1-920s1c1
Sequence:CCGGGACCTAAATTGCCAGCTCCAACTCGAGTTGGAGCTGGCAATTTAGGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_006297.1-1489s1c1
Sequence:CCGGCCAGTGCTCCAGGAAGATATACTCGAGTATATCTTCCTGGAGCACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285033    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006297.2-1504s21c1
Sequence:CCGGCCAGTGCTCCAGGAAGATATACTCGAGTATATCTTCCTGGAGCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1748s21c1
Sequence:CCGGTCCAGGGCAAGCACTTCTTTCCTCGAGGAAAGAAGTGCTTGCCCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1541s21c1
Sequence:CCGGAGTCAGAAGGACAGGACAATGCTCGAGCATTGTCCTGTCCTTCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000273634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006297.2-1810s21c1
Sequence:CCGGCGATACGTCACAGCCTTCAATCTCGAGATTGAAGGCTGTGACGTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks