EMAIL THIS PAGE TO A FRIEND

XRCC2

X-ray repair complementing defective repair in Chinese hamster cells 2

UniProtKB ID: O43543, B2R925
Gene ID:
Human(7516) Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene is involved in the repair of DNA double-strand breaks by homologous recombination and it functionally complements Chinese hamster irs1, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents. [provided by RefSeq, Jul 2008]
Mouse(57434) X-ray repair complementing defective repair in Chinese hamster cells 2
Rat(499966) X-ray repair complementing defective repair in Chinese hamster cells 2
Thale Cress(836573) DNA repair protein XRCC2-like protein
chicken(420438) X-ray repair complementing defective repair in Chinese hamster cells 2
dog(475548) X-ray repair complementing defective repair in Chinese hamster cells 2
domestic guinea pig(100716725) X-ray repair complementing defective repair in Chinese hamster cells 2
cow(789410) X-ray repair complementing defective repair in Chinese hamster cells 2
sheep(101105407) X-ray repair complementing defective repair in Chinese hamster cells 2
Gene Class: ATPase
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_020570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_020570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005431 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005431 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005431 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005431 Rosetta Predictions human pricing
NM_001109215 Rosetta Predictions rat pricing
NM_020570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005431 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128806 predicted 639
2 SASI_Hs01_00128808 predicted 727
3 SASI_Hs01_00128809 predicted 682
4 SASI_Hs01_00128810 predicted 732
5 SASI_Hs01_00128811 predicted 748
6 SASI_Hs01_00128812 predicted 755
7 SASI_Hs02_00339581 predicted 730
8 SASI_Hs01_00128813 predicted 743
9 SASI_Hs01_00128814 predicted 684
10 SASI_Hs01_00128815 predicted 685
11 SASI_Hs01_00128807 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109215 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00246220 predicted 331
2 SASI_Rn02_00246221 predicted 287
3 SASI_Rn02_00246222 predicted 295
4 SASI_Rn02_00246223 predicted 514
5 SASI_Rn02_00246224 predicted 296
6 SASI_Rn02_00246225 predicted 1392
7 SASI_Rn02_00246226 predicted 1299
8 SASI_Rn02_00246227 predicted 1373
9 SASI_Rn02_00246228 predicted 987
10 SASI_Rn02_00246229 predicted 933
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00325621 predicted 299
2 SASI_Mm02_00325622 predicted 833
3 SASI_Mm02_00325623 predicted 1106
4 SASI_Mm02_00325624 predicted 242
5 SASI_Mm02_00325625 predicted 978
6 SASI_Mm02_00325626 predicted 1223
7 SASI_Mm02_00325627 predicted 1325
8 SASI_Mm02_00325628 predicted 944
9 SASI_Mm02_00325629 predicted 629
10 SASI_Mm02_00325630 predicted 1121
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020570
VALIDATED
XRCC2 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-191s21c1
Sequence:CCGGCACCAGTGCACGGTGATATTTCTCGAGAAATATCACCGTGCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020570.2-946s21c1
Sequence:CCGGGCACTAAGGCAAGTCTTTAAACTCGAGTTTAAAGACTTGCCTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-834s21c1
Sequence:CCGGCTCATTAGTTTCACGTCATTTCTCGAGAAATGACGTGAAACTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-166s21c1
Sequence:CCGGCCCAACCTGTTTGCTGATGAACTCGAGTTCATCAGCAAACAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-331s21c1
Sequence:CCGGGATTACCACTTTGACATGCTACTCGAGTAGCATGTCAAAGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-299s1c1
Sequence:CCGGGACTGCAAATAGAAGTCTTATCTCGAGATAAGACTTCTATTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-331s1c1
Sequence:CCGGGATTACCACTTTGACATGCTACTCGAGTAGCATGTCAAAGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020570.2-824s1c1
Sequence:CCGGGCAGCCGGTTCTCATTAGTTTCTCGAGAAACTAATGAGAACCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-166s1c1
Sequence:CCGGCCCAACCTGTTTGCTGATGAACTCGAGTTCATCAGCAAACAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-834s1c1
Sequence:CCGGCTCATTAGTTTCACGTCATTTCTCGAGAAATGACGTGAAACTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020570
VALIDATED
XRCC2 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-191s21c1
Sequence:CCGGCACCAGTGCACGGTGATATTTCTCGAGAAATATCACCGTGCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020570.2-946s21c1
Sequence:CCGGGCACTAAGGCAAGTCTTTAAACTCGAGTTTAAAGACTTGCCTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-834s21c1
Sequence:CCGGCTCATTAGTTTCACGTCATTTCTCGAGAAATGACGTGAAACTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-166s21c1
Sequence:CCGGCCCAACCTGTTTGCTGATGAACTCGAGTTCATCAGCAAACAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-331s21c1
Sequence:CCGGGATTACCACTTTGACATGCTACTCGAGTAGCATGTCAAAGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-299s1c1
Sequence:CCGGGACTGCAAATAGAAGTCTTATCTCGAGATAAGACTTCTATTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-331s1c1
Sequence:CCGGGATTACCACTTTGACATGCTACTCGAGTAGCATGTCAAAGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020570.2-824s1c1
Sequence:CCGGGCAGCCGGTTCTCATTAGTTTCTCGAGAAACTAATGAGAACCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-166s1c1
Sequence:CCGGCCCAACCTGTTTGCTGATGAACTCGAGTTCATCAGCAAACAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-834s1c1
Sequence:CCGGCTCATTAGTTTCACGTCATTTCTCGAGAAATGACGTGAAACTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020570
VALIDATED
XRCC2 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307442    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-191s21c1
Sequence:CCGGCACCAGTGCACGGTGATATTTCTCGAGAAATATCACCGTGCACTGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294883    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_020570.2-946s21c1
Sequence:CCGGGCACTAAGGCAAGTCTTTAAACTCGAGTTTAAAGACTTGCCTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-834s21c1
Sequence:CCGGCTCATTAGTTTCACGTCATTTCTCGAGAAATGACGTGAAACTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287387    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-166s21c1
Sequence:CCGGCCCAACCTGTTTGCTGATGAACTCGAGTTCATCAGCAAACAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287388    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020570.2-331s21c1
Sequence:CCGGGATTACCACTTTGACATGCTACTCGAGTAGCATGTCAAAGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-299s1c1
Sequence:CCGGGACTGCAAATAGAAGTCTTATCTCGAGATAAGACTTCTATTTGCAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-331s1c1
Sequence:CCGGGATTACCACTTTGACATGCTACTCGAGTAGCATGTCAAAGTGGTAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020570.2-824s1c1
Sequence:CCGGGCAGCCGGTTCTCATTAGTTTCTCGAGAAACTAATGAGAACCGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071025    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-166s1c1
Sequence:CCGGCCCAACCTGTTTGCTGATGAACTCGAGTTCATCAGCAAACAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071024    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_020570.2-834s1c1
Sequence:CCGGCTCATTAGTTTCACGTCATTTCTCGAGAAATGACGTGAAACTAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005431
VALIDATED
XRCC2 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000255927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-347s21c1
Sequence:CCGGTGATATGCTCCGGCTAGTTACCTCGAGGTAACTAGCCGGAGCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-846s21c1
Sequence:CCGGTCATTAGTTTCACGTTGTTTACTCGAGTAAACAACGTGAAACTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005431.1-662s21c1
Sequence:CCGGTGCAACGACACAAACTATAATCTCGAGATTATAGTTTGTGTCGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000255928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005431.1-1848s21c1
Sequence:CCGGATGAGACCACACACCTATAATCTCGAGATTATAGGTGTGTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-264s21c1
Sequence:CCGGCACCTAACAGCACGATGTATACTCGAGTATACATCGTGCTGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005431.1-2465s1c1
Sequence:CCGGCCAGTCCAAATGGCTATTATACTCGAGTATAATAGCCATTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-456s1c1
Sequence:CCGGACCCACTTACTTCTTACACTTCTCGAGAAGTGTAAGAAGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-133s1c1
Sequence:CCGGCCCGACTTGAAGGTAGAAGTTCTCGAGAACTTCTACCTTCAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-457s1c1
Sequence:CCGGCCCACTTACTTCTTACACTTTCTCGAGAAAGTGTAAGAAGTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005431
VALIDATED
XRCC2 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000255927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-347s21c1
Sequence:CCGGTGATATGCTCCGGCTAGTTACCTCGAGGTAACTAGCCGGAGCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-846s21c1
Sequence:CCGGTCATTAGTTTCACGTTGTTTACTCGAGTAAACAACGTGAAACTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005431.1-662s21c1
Sequence:CCGGTGCAACGACACAAACTATAATCTCGAGATTATAGTTTGTGTCGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000255928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005431.1-1848s21c1
Sequence:CCGGATGAGACCACACACCTATAATCTCGAGATTATAGGTGTGTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-264s21c1
Sequence:CCGGCACCTAACAGCACGATGTATACTCGAGTATACATCGTGCTGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005431.1-2465s1c1
Sequence:CCGGCCAGTCCAAATGGCTATTATACTCGAGTATAATAGCCATTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-456s1c1
Sequence:CCGGACCCACTTACTTCTTACACTTCTCGAGAAGTGTAAGAAGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-133s1c1
Sequence:CCGGCCCGACTTGAAGGTAGAAGTTCTCGAGAACTTCTACCTTCAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-457s1c1
Sequence:CCGGCCCACTTACTTCTTACACTTTCTCGAGAAAGTGTAAGAAGTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005431
VALIDATED
XRCC2 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000255927    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-347s21c1
Sequence:CCGGTGATATGCTCCGGCTAGTTACCTCGAGGTAACTAGCCGGAGCATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255929    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-846s21c1
Sequence:CCGGTCATTAGTTTCACGTTGTTTACTCGAGTAAACAACGTGAAACTAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_005431.1-662s21c1
Sequence:CCGGTGCAACGACACAAACTATAATCTCGAGATTATAGTTTGTGTCGTTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000255928    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005431.1-1848s21c1
Sequence:CCGGATGAGACCACACACCTATAATCTCGAGATTATAGGTGTGTGGTCTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265830    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005431.1-264s21c1
Sequence:CCGGCACCTAACAGCACGATGTATACTCGAGTATACATCGTGCTGTTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083058    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005431.1-2465s1c1
Sequence:CCGGCCAGTCCAAATGGCTATTATACTCGAGTATAATAGCCATTTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-456s1c1
Sequence:CCGGACCCACTTACTTCTTACACTTCTCGAGAAGTGTAAGAAGTAAGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-133s1c1
Sequence:CCGGCCCGACTTGAAGGTAGAAGTTCTCGAGAACTTCTACCTTCAAGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005431.1-457s1c1
Sequence:CCGGCCCACTTACTTCTTACACTTTCTCGAGAAAGTGTAAGAAGTAAGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks