EMAIL THIS PAGE TO A FRIEND

XRCC3

X-ray repair complementing defective repair in Chinese hamster cells 3

Synonyms: CMM6
UniProtKB ID: O43542, O43568, Q9BU18
Gene ID:
Human(7517) Summary: This gene encodes a member of the RecA/Rad51-related protein family that participates in homologous recombination to maintain chromosome stability and repair DNA damage. This gene functionally complements Chinese hamster irs1SF, a repair-deficient mutant that exhibits hypersensitivity to a number of different DNA-damaging agents and is chromosomally unstable. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
Mouse(74335) X-ray repair complementing defective repair in Chinese hamster cells 3
Rat(100359601) X-ray repair complementing defective repair in Chinese hamster cells 3
cow(768244) X-ray repair complementing defective repair in Chinese hamster cells 3
domestic guinea pig(100723056) X-ray repair complementing defective repair in Chinese hamster cells 3
naked mole-rat(101699387) X-ray repair complementing defective repair in Chinese hamster cells 3
Thale Cress(835850) DNA repair protein XRCC3-like protein
dog(100687200) X-ray repair complementing defective repair in Chinese hamster cells 3
chicken(423485) X-ray repair complementing defective repair in Chinese hamster cells 3
Zebrafish(541414) X-ray repair complementing defective repair in Chinese hamster cells 3
Gene Class: ATPase
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
GW22035A Anti-XRCC3 (ab1) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
western blot pricing
GW22035B Anti-XRCC3 (ab2) antibody produced in chicken affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
X4003 Anti-XRCC3 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
SAB4503092 Anti-XRCC3 antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4503093 Anti-XRCC3 antibody produced in rabbit affinity isolated antibody human
immunofluorescence, immunohistochemistry pricing
HPA070565 Anti-XRCC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
HPA062422 Anti-XRCC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
HPA068953 Anti-XRCC3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence, western blot pricing
X4128 Anti-XRCC4 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension rodent, human
immunohistochemistry, western blot pricing
X2004 Anti-XRCC4 antibody produced in rabbit whole antiserum human
western blot pricing
SAB1402961 Monoclonal Anti-XRCC3 antibody produced in mouse clone 1H7, purified immunoglobulin, buffered aqueous solution human
ELISA pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005432 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005432 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005432 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001100118 Rosetta Predictions human pricing
NM_001100119 Rosetta Predictions human pricing
NM_005432 Rosetta Predictions human pricing
NM_028875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100118 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321674 predicted 851
2 SASI_Hs02_00321675 predicted 762
3 SASI_Hs02_00321676 predicted 347
4 SASI_Hs02_00321677 predicted 724
5 SASI_Hs02_00321678 predicted 1801
6 SASI_Hs02_00321679 predicted 882
7 SASI_Hs02_00321680 predicted 1169
8 SASI_Hs02_00321681 predicted 359
9 SASI_Hs02_00321682 predicted 880
10 SASI_Hs02_00321683 predicted 744
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100119 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321684 predicted 943
2 SASI_Hs02_00321685 predicted 847
3 SASI_Hs02_00321686 predicted 441
4 SASI_Hs02_00321687 predicted 819
5 SASI_Hs02_00321688 predicted 1898
6 SASI_Hs02_00321689 predicted 978
7 SASI_Hs02_00321690 predicted 1261
8 SASI_Hs02_00321691 predicted 451
9 SASI_Hs02_00321692 predicted 976
10 SASI_Hs02_00321693 predicted 840
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005432 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00211578 predicted 909
2 SASI_Hs01_00211579 predicted 812
3 SASI_Hs01_00211581 predicted 405
4 SASI_Hs01_00211583 predicted 786
5 SASI_Hs01_00211586 predicted 1862
6 SASI_Hs01_00211584 predicted 936
7 SASI_Hs01_00211585 predicted 1226
8 SASI_Hs01_00211587 predicted 412
9 SASI_Hs02_00339582 predicted 946
10 SASI_Hs02_00339583 predicted 802
11 SASI_Hs01_00211580 predicted 1728
12 SASI_Hs01_00211582 predicted 1719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111884 predicted 1036
2 SASI_Mm01_00111885 predicted 1046
3 SASI_Mm01_00111886 predicted 1162
4 SASI_Mm01_00111887 predicted 1274
5 SASI_Mm01_00111888 predicted 685
6 SASI_Mm01_00111889 predicted 330
7 SASI_Mm01_00111890 predicted 1270
8 SASI_Mm01_00111891 predicted 1052
9 SASI_Mm01_00111893 predicted 630
10 SASI_Mm02_00334551 predicted 779
11 SASI_Mm01_00111892 predicted 638
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005432
XRCC3 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 3
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000083046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-858s1c1
Sequence:CCGGCTGCTTCAGAAGCTCCGATTTCTCGAGAAATCGGAGCTTCTGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005432.2-1719s1c1
Sequence:CCGGGCCTGCTTCTTCTCTCCATATCTCGAGATATGGAGAGAAGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-381s1c1
Sequence:CCGGCCCAGAATTATTGCTGCAATTCTCGAGAATTGCAGCAATAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-393s1c1
Sequence:CCGGGCTGCAATTAAGAAAGCCAAACTCGAGTTTGGCTTTCTTAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-920s1c1
Sequence:CCGGCTTGTTGGAGTGTGTGAATAACTCGAGTTATTCACACACTCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1031s21c1
Sequence:CCGGCCCATTCCGCTGTGAATTTGACTCGAGTCAAATTCACAGCGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1360s21c1
Sequence:CCGGCCTGTTCCTACACGATCAGTGCTCGAGCACTGATCGTGTAGGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1202s21c1
Sequence:CCGGGTTCTGGGACGAACGTGTTTCCTCGAGGAAACACGTTCGTCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-530s21c1
Sequence:CCGGGAGAACGGCCTCCTTACACTTCTCGAGAAGTGTAAGGAGGCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005432
XRCC3 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 3
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000083046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-858s1c1
Sequence:CCGGCTGCTTCAGAAGCTCCGATTTCTCGAGAAATCGGAGCTTCTGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005432.2-1719s1c1
Sequence:CCGGGCCTGCTTCTTCTCTCCATATCTCGAGATATGGAGAGAAGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-381s1c1
Sequence:CCGGCCCAGAATTATTGCTGCAATTCTCGAGAATTGCAGCAATAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-393s1c1
Sequence:CCGGGCTGCAATTAAGAAAGCCAAACTCGAGTTTGGCTTTCTTAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-920s1c1
Sequence:CCGGCTTGTTGGAGTGTGTGAATAACTCGAGTTATTCACACACTCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1031s21c1
Sequence:CCGGCCCATTCCGCTGTGAATTTGACTCGAGTCAAATTCACAGCGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1360s21c1
Sequence:CCGGCCTGTTCCTACACGATCAGTGCTCGAGCACTGATCGTGTAGGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1202s21c1
Sequence:CCGGGTTCTGGGACGAACGTGTTTCCTCGAGGAAACACGTTCGTCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-530s21c1
Sequence:CCGGGAGAACGGCCTCCTTACACTTCTCGAGAAGTGTAAGGAGGCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005432
XRCC3 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 3
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000083046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-858s1c1
Sequence:CCGGCTGCTTCAGAAGCTCCGATTTCTCGAGAAATCGGAGCTTCTGAAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005432.2-1719s1c1
Sequence:CCGGGCCTGCTTCTTCTCTCCATATCTCGAGATATGGAGAGAAGAAGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-381s1c1
Sequence:CCGGCCCAGAATTATTGCTGCAATTCTCGAGAATTGCAGCAATAATTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-393s1c1
Sequence:CCGGGCTGCAATTAAGAAAGCCAAACTCGAGTTTGGCTTTCTTAATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005432.2-920s1c1
Sequence:CCGGCTTGTTGGAGTGTGTGAATAACTCGAGTTATTCACACACTCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1031s21c1
Sequence:CCGGCCCATTCCGCTGTGAATTTGACTCGAGTCAAATTCACAGCGGAATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1360s21c1
Sequence:CCGGCCTGTTCCTACACGATCAGTGCTCGAGCACTGATCGTGTAGGAACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-1202s21c1
Sequence:CCGGGTTCTGGGACGAACGTGTTTCCTCGAGGAAACACGTTCGTCCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005432.3-530s21c1
Sequence:CCGGGAGAACGGCCTCCTTACACTTCTCGAGAAGTGTAAGGAGGCCGTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028875
XRCC3 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-688s1c1
Sequence:CCGGCTTGTTGGAGTGTGTGAGTAACTCGAGTTACTCACACACTCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-1150s1c1
Sequence:CCGGGCCAGGAACACAGTCCTACTACTCGAGTAGTAGGACTGTGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-631s1c1
Sequence:CCGGCGAGAAGATCAGGTTCAGCAACTCGAGTTGCTGAACCTGATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-151s1c1
Sequence:CCGGCCGAATTACTGCTGCGGTTAACTCGAGTTAACCGCAGCAGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028875.1-1212s1c1
Sequence:CCGGCCCTGATTCTGATGACTCTTTCTCGAGAAAGAGTCATCAGAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028875.2-503s21c1
Sequence:CCGGAGACAATATGGAGGCCTAGAGCTCGAGCTCTAGGCCTCCATATTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028875.2-1278s21c1
Sequence:CCGGGACGGTTAGTCTGTCAGTATCCTCGAGGATACTGACAGACTAACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028875.2-998s21c1
Sequence:CCGGCTGATGCGACTGATGGTTGACCTCGAGGTCAACCATCAGTCGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028875
XRCC3 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-688s1c1
Sequence:CCGGCTTGTTGGAGTGTGTGAGTAACTCGAGTTACTCACACACTCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-1150s1c1
Sequence:CCGGGCCAGGAACACAGTCCTACTACTCGAGTAGTAGGACTGTGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-631s1c1
Sequence:CCGGCGAGAAGATCAGGTTCAGCAACTCGAGTTGCTGAACCTGATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-151s1c1
Sequence:CCGGCCGAATTACTGCTGCGGTTAACTCGAGTTAACCGCAGCAGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028875.1-1212s1c1
Sequence:CCGGCCCTGATTCTGATGACTCTTTCTCGAGAAAGAGTCATCAGAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028875.2-503s21c1
Sequence:CCGGAGACAATATGGAGGCCTAGAGCTCGAGCTCTAGGCCTCCATATTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028875.2-1278s21c1
Sequence:CCGGGACGGTTAGTCTGTCAGTATCCTCGAGGATACTGACAGACTAACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028875.2-998s21c1
Sequence:CCGGCTGATGCGACTGATGGTTGACCTCGAGGTCAACCATCAGTCGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028875
XRCC3 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-688s1c1
Sequence:CCGGCTTGTTGGAGTGTGTGAGTAACTCGAGTTACTCACACACTCCAACAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-1150s1c1
Sequence:CCGGGCCAGGAACACAGTCCTACTACTCGAGTAGTAGGACTGTGTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-631s1c1
Sequence:CCGGCGAGAAGATCAGGTTCAGCAACTCGAGTTGCTGAACCTGATCTTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028875.1-151s1c1
Sequence:CCGGCCGAATTACTGCTGCGGTTAACTCGAGTTAACCGCAGCAGTAATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071033    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028875.1-1212s1c1
Sequence:CCGGCCCTGATTCTGATGACTCTTTCTCGAGAAAGAGTCATCAGAATCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028875.2-503s21c1
Sequence:CCGGAGACAATATGGAGGCCTAGAGCTCGAGCTCTAGGCCTCCATATTGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437574    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_028875.2-1278s21c1
Sequence:CCGGGACGGTTAGTCTGTCAGTATCCTCGAGGATACTGACAGACTAACCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_028875.2-998s21c1
Sequence:CCGGCTGATGCGACTGATGGTTGACCTCGAGGTCAACCATCAGTCGCATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks