EMAIL THIS PAGE TO A FRIEND

XRCC4

X-ray repair complementing defective repair in Chinese hamster cells 4

UniProtKB ID: Q13426, A8K3X4, Q9BS72, Q9UP94
Gene ID:
Human(7518) Summary: The protein encoded by this gene functions together with DNA ligase IV and the DNA-dependent protein kinase in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. The non-homologous end-joining pathway is required both for normal development and for suppression of tumors. This gene functionally complements XR-1 Chinese hamster ovary cell mutant, which is impaired in DNA double-strand breaks produced by ionizing radiation and restriction enzymes. Alternative transcription initiation and alternative splicing generates several transcript variants. [provided by RefSeq, Sep 2008]
Mouse(108138) X-ray repair complementing defective repair in Chinese hamster cells 4
Rat(309995) X-ray repair complementing defective repair in Chinese hamster cells 4
Thale Cress(821885) DNA repair protein XRCC4-like protein
Zebrafish(393759) X-ray repair complementing defective repair in Chinese hamster cells 4
dog(488923) X-ray repair complementing defective repair in Chinese hamster cells 4
chicken(427325) X-ray repair complementing defective repair in Chinese hamster cells 4
naked mole-rat(101709691) X-ray repair complementing defective repair in Chinese hamster cells 4
domestic guinea pig(100731158) X-ray repair complementing defective repair in Chinese hamster cells 4
cow(613590) X-ray repair complementing defective repair in Chinese hamster cells 4
sheep(101102481) X-ray repair complementing defective repair in Chinese hamster cells 4
140 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022406 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022406 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022406 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_028012 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028012 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028012 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003401 Rosetta Predictions human pricing
NM_022406 Rosetta Predictions human pricing
NM_022550 Rosetta Predictions human pricing
NM_001006999 Rosetta Predictions rat pricing
NM_028012 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003401 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114716 predicted 584
2 SASI_Hs01_00114717 predicted 1402
3 SASI_Hs01_00114718 predicted 765
4 SASI_Hs01_00114719 predicted 491
5 SASI_Hs01_00114720 predicted 1274
6 SASI_Hs01_00114721 predicted 1280
7 SASI_Hs01_00114722 predicted 1419
8 SASI_Hs01_00114723 predicted 498
9 SASI_Hs01_00114724 predicted 1334
10 SASI_Hs01_00114725 predicted 427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022406 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00057363 predicted 582
2 SASI_Hs01_00057364 predicted 1401
3 SASI_Hs01_00057365 predicted 770
4 SASI_Hs01_00057366 predicted 490
5 SASI_Hs01_00057367 predicted 1281
6 SASI_Hs01_00057368 predicted 1285
7 SASI_Hs01_00057369 predicted 1424
8 SASI_Hs01_00057370 predicted 495
9 SASI_Hs01_00057371 predicted 1331
10 SASI_Hs01_00057372 predicted 423
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022550 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090893 predicted 633
2 SASI_Hs01_00090894 predicted 1448
3 SASI_Hs01_00090895 predicted 818
4 SASI_Hs01_00090896 predicted 530
5 SASI_Hs01_00090897 predicted 1330
6 SASI_Hs01_00090898 predicted 1325
7 SASI_Hs01_00090899 predicted 1463
8 SASI_Hs01_00090900 predicted 540
9 SASI_Hs01_00090901 predicted 1379
10 SASI_Hs01_00090902 predicted 469
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006999 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105453 predicted 383
2 SASI_Rn01_00105454 predicted 475
3 SASI_Rn01_00105456 predicted 634
4 SASI_Rn01_00105457 predicted 268
5 SASI_Rn01_00105458 predicted 941
6 SASI_Rn01_00105459 predicted 1068
7 SASI_Rn01_00105460 predicted 824
8 SASI_Rn01_00105461 predicted 945
9 SASI_Rn01_00105462 predicted 335
10 SASI_Rn02_00198585 predicted 647
11 SASI_Rn01_00105455 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028012 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181645 predicted 493
2 SASI_Mm01_00181646 predicted 996
3 SASI_Mm01_00181647 predicted 655
4 SASI_Mm01_00181648 predicted 612
5 SASI_Mm01_00181649 predicted 309
6 SASI_Mm02_00333127 predicted 388
7 SASI_Mm01_00181650 predicted 1049
8 SASI_Mm01_00181652 predicted 344
9 SASI_Mm01_00181654 predicted 805
10 SASI_Mm02_00333128 predicted 200
11 SASI_Mm01_00181651 predicted 1010
12 SASI_Mm01_00181653 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022406
VALIDATED
XRCC4 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 4
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022406.2-907s21c1
Sequence:CCGGGTCTTGATGTCACTGATATTGCTCGAGCAATATCAGTGACATCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022406.2-595s21c1
Sequence:CCGGATGATGTTCAAGGACGATTTGCTCGAGCAAATCGTCCTTGAACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.x-513s1c1
Sequence:CCGGTATTGCTTGGACACCATTGCACTCGAGTGCAATGGTGTCCAAGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.x-621s1c1
Sequence:CCGGTGTGTGAGTGCTAAGGAAGCTCTCGAGAGCTTCCTTAGCACTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022406.1-1331s1c1
Sequence:CCGGGCACATTGAGTTCTAAACTATCTCGAGATAGTTTAGAACTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022406.1-662s1c1
Sequence:CCGGCGGTTTATTCTGGTGTTGAATCTCGAGATTCAACACCAGAATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022406.1-872s1c1
Sequence:CCGGGCTGCTGTAAGTAAAGATGATCTCGAGATCATCTTTACTTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.1-989s1c1
Sequence:CCGGCCTCAGGAGAATCAGCTTCAACTCGAGTTGAAGCTGATTCTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022406
VALIDATED
XRCC4 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 4
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022406.2-907s21c1
Sequence:CCGGGTCTTGATGTCACTGATATTGCTCGAGCAATATCAGTGACATCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022406.2-595s21c1
Sequence:CCGGATGATGTTCAAGGACGATTTGCTCGAGCAAATCGTCCTTGAACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.x-513s1c1
Sequence:CCGGTATTGCTTGGACACCATTGCACTCGAGTGCAATGGTGTCCAAGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.x-621s1c1
Sequence:CCGGTGTGTGAGTGCTAAGGAAGCTCTCGAGAGCTTCCTTAGCACTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022406.1-1331s1c1
Sequence:CCGGGCACATTGAGTTCTAAACTATCTCGAGATAGTTTAGAACTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022406.1-662s1c1
Sequence:CCGGCGGTTTATTCTGGTGTTGAATCTCGAGATTCAACACCAGAATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022406.1-872s1c1
Sequence:CCGGGCTGCTGTAAGTAAAGATGATCTCGAGATCATCTTTACTTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.1-989s1c1
Sequence:CCGGCCTCAGGAGAATCAGCTTCAACTCGAGTTGAAGCTGATTCTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022406
VALIDATED
XRCC4 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 4
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022406.2-907s21c1
Sequence:CCGGGTCTTGATGTCACTGATATTGCTCGAGCAATATCAGTGACATCAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421915    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022406.2-595s21c1
Sequence:CCGGATGATGTTCAAGGACGATTTGCTCGAGCAAATCGTCCTTGAACATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009874    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.x-513s1c1
Sequence:CCGGTATTGCTTGGACACCATTGCACTCGAGTGCAATGGTGTCCAAGCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009875    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.x-621s1c1
Sequence:CCGGTGTGTGAGTGCTAAGGAAGCTCTCGAGAGCTTCCTTAGCACTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040113    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022406.1-1331s1c1
Sequence:CCGGGCACATTGAGTTCTAAACTATCTCGAGATAGTTTAGAACTCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022406.1-662s1c1
Sequence:CCGGCGGTTTATTCTGGTGTTGAATCTCGAGATTCAACACCAGAATAAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022406.1-872s1c1
Sequence:CCGGGCTGCTGTAAGTAAAGATGATCTCGAGATCATCTTTACTTACAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_022406.1-989s1c1
Sequence:CCGGCCTCAGGAGAATCAGCTTCAACTCGAGTTGAAGCTGATTCTCCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028012
VALIDATED
XRCC4 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-1040s1c1
Sequence:CCGGGCACTGGTGTTCAATGAACTACTCGAGTAGTTCATTGAACACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-128s1c1
Sequence:CCGGCCGGCTTTGTTATTACACTTACTCGAGTAAGTGTAATAACAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-615s1c1
Sequence:CCGGGAGCTTGCATAAATTGCTAAACTCGAGTTTAGCAATTTATGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-368s1c1
Sequence:CCGGCCTTCAACCTAGACAAAGTTTCTCGAGAAACTTTGTCTAGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-972s1c1
Sequence:CCGGGTCTTTAGAAACCCTGAGAAACTCGAGTTTCTCAGGGTTTCTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028012
VALIDATED
XRCC4 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-1040s1c1
Sequence:CCGGGCACTGGTGTTCAATGAACTACTCGAGTAGTTCATTGAACACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-128s1c1
Sequence:CCGGCCGGCTTTGTTATTACACTTACTCGAGTAAGTGTAATAACAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-615s1c1
Sequence:CCGGGAGCTTGCATAAATTGCTAAACTCGAGTTTAGCAATTTATGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-368s1c1
Sequence:CCGGCCTTCAACCTAGACAAAGTTTCTCGAGAAACTTTGTCTAGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-972s1c1
Sequence:CCGGGTCTTTAGAAACCCTGAGAAACTCGAGTTTCTCAGGGTTTCTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028012
VALIDATED
XRCC4 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125339    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-1040s1c1
Sequence:CCGGGCACTGGTGTTCAATGAACTACTCGAGTAGTTCATTGAACACCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-128s1c1
Sequence:CCGGCCGGCTTTGTTATTACACTTACTCGAGTAAGTGTAATAACAAAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-615s1c1
Sequence:CCGGGAGCTTGCATAAATTGCTAAACTCGAGTTTAGCAATTTATGCAAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-368s1c1
Sequence:CCGGCCTTCAACCTAGACAAAGTTTCTCGAGAAACTTTGTCTAGGTTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_028012.1-972s1c1
Sequence:CCGGGTCTTTAGAAACCCTGAGAAACTCGAGTTTCTCAGGGTTTCTAAAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks