EMAIL THIS PAGE TO A FRIEND

XRCC5

X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)

Synonyms: KARP-1 KARP1 KU80 KUB2 Ku86 NFIV
Gene ID:
Human(7520) Summary: The protein encoded by this gene is the 80-kilodalton subunit of the Ku heterodimer protein which is also known as ATP-dependant DNA helicase II or DNA repair protein XRCC5. Ku is the DNA-binding component of the DNA-dependent protein kinase, and it functions together with the DNA ligase IV-XRCC4 complex in the repair of DNA double-strand break by non-homologous end joining and the completion of V(D)J recombination events. This gene functionally complements Chinese hamster xrs-6, a mutant defective in DNA double-strand break repair and in ability to undergo V(D)J recombination. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
Mouse(22596) X-ray repair complementing defective repair in Chinese hamster cells 5
Rat(363247) X-ray repair complementing defective repair in Chinese hamster cells 5
sheep(101107255) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
domestic guinea pig(100728001) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
naked mole-rat(101719341) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Domestic Rabbit(100347656) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Zebrafish(449848) X-ray repair complementing defective repair in Chinese hamster cells 5
Horse(100055031) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
domestic cat(101083534) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
dog(478902) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
chicken(424222) X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4503096 Anti-KU70, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
K3389 Anti-Ku80 (XRCC5) (322-337) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
K3264 Anti-Ku80 (XRCC5) (418-439) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB5500135 Anti-KU80 antibody, Rabbit monoclonal recombinant, expressed in proprietary host, clone SP130, affinity isolated antibody human (tested)
immunohistochemistry, western blot pricing
SAB4503095 Anti-KU80, C-Terminal antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB2500579 Anti-KU80/XRCC5 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB4503891 Anti-phospho-Ku80 (pThr714) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, western blot pricing
AV34121 Anti-XRCC5 antibody produced in rabbit IgG fraction of antiserum , guinea pig, bovine, horse, rat, human, mouse, rabbit
immunohistochemistry, western blot pricing
HPA025813 Anti-XRCC5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4503098 Anti-XRCC5 antibody produced in rabbit affinity isolated antibody human
ELISA, western blot pricing
HPA064685 Anti-XRCC5 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
SAB4503097 Anti-XRCC5, C-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
WH0007520M2 Monoclonal Anti-XRCC5 antibody produced in mouse clone 3D8, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5300182 Monoclonal Anti-XRCC5 antibody produced in mouse clone 5C5, ascites fluid human, mouse
ELISA, flow cytometry, immunofluorescence, immunohistochemistry, western blot pricing
PLA0264 Rabbit anti-Ku80 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. gorilla, chimpanzee, human
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021141 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021141 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021141 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009533 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009533 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009533 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021141 Rosetta Predictions human pricing
NM_177419 Rosetta Predictions rat pricing
NM_009533 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021141 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00099411 predicted 2015
2 SASI_Hs01_00099412 predicted 1867
3 SASI_Hs01_00099413 predicted 466
4 SASI_Hs01_00099414 predicted 1698
5 SASI_Hs01_00099415 predicted 2206
6 SASI_Hs01_00099416 predicted 2295
7 SASI_Hs01_00099417 predicted 1379
8 SASI_Hs01_00099418 predicted 2108
9 SASI_Hs01_00099419 predicted 2263
10 SASI_Hs01_00099420 predicted 1158
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177419 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042562 predicted 1126
2 SASI_Rn01_00042563 predicted 880
3 SASI_Rn01_00042564 predicted 1170
4 SASI_Rn01_00042565 predicted 209
5 SASI_Rn02_00269579 predicted 2096
6 SASI_Rn01_00042566 predicted 967
7 SASI_Rn01_00042567 predicted 1473
8 SASI_Rn01_00042569 predicted 1029
9 SASI_Rn01_00042570 predicted 1338
10 SASI_Rn01_00042571 predicted 1979
11 SASI_Rn01_00042568 predicted 510
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009533 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316350 predicted 1191
2 SASI_Mm02_00316351 predicted 1499
3 SASI_Mm02_00316352 predicted 233
4 SASI_Mm02_00316353 predicted 2004
5 SASI_Mm02_00316354 predicted 817
6 SASI_Mm02_00316355 predicted 1053
7 SASI_Mm02_00316356 predicted 2150
8 SASI_Mm02_00316357 predicted 561
9 SASI_Mm02_00316358 predicted 420
10 SASI_Mm02_00316359 predicted 2299
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021141
VALIDATED
XRCC5 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000039838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021141.2-2571s1c1
Sequence:CCGGGCAGCCCTTGTGATGTGATTACTCGAGTAATCACATCACAAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-78s1c1
Sequence:CCGGCGTGGGCTTTACCATGAGTAACTCGAGTTACTCATGGTAAAGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-1261s1c1
Sequence:CCGGCCTCATATCAAGCATAACTATCTCGAGATAGTTATGCTTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021141.2-513s1c1
Sequence:CCGGCCTGCAATTCTTCTTGCCTTTCTCGAGAAAGGCAAGAAGAATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-1993s1c1
Sequence:CCGGCGCTTTAACAACTTCCTGAAACTCGAGTTTCAGGAAGTTGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-1707s1c1
Sequence:CCGGTGAAGATGGACCTACAGCTAACTCGAGTTAGCTGTAGGTCCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-2250s1c1
Sequence:CCGGAATCTAAGAGAGCTGCCATCGCTCGAGCGATGGCAGCTCTCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-2097s1c1
Sequence:CCGGAGAGGAAGCCTCTGGAAGTTCCTCGAGGAACTTCCAGAGGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-185s21c1
Sequence:CCGGCGTGGGCTTTACCATGAGTAACTCGAGTTACTCATGGTAAAGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000288700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021141.3-1368s21c1
Sequence:CCGGCCTCATATCAAGCATAACTATCTCGAGATAGTTATGCTTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-2204s21c1
Sequence:CCGGAGAGGAAGCCTCTGGAAGTTCCTCGAGGAACTTCCAGAGGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-2357s21c1
Sequence:CCGGAATCTAAGAGAGCTGCCATCGCTCGAGCGATGGCAGCTCTCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021141
VALIDATED
XRCC5 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000039838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021141.2-2571s1c1
Sequence:CCGGGCAGCCCTTGTGATGTGATTACTCGAGTAATCACATCACAAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-78s1c1
Sequence:CCGGCGTGGGCTTTACCATGAGTAACTCGAGTTACTCATGGTAAAGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-1261s1c1
Sequence:CCGGCCTCATATCAAGCATAACTATCTCGAGATAGTTATGCTTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021141.2-513s1c1
Sequence:CCGGCCTGCAATTCTTCTTGCCTTTCTCGAGAAAGGCAAGAAGAATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-1993s1c1
Sequence:CCGGCGCTTTAACAACTTCCTGAAACTCGAGTTTCAGGAAGTTGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-1707s1c1
Sequence:CCGGTGAAGATGGACCTACAGCTAACTCGAGTTAGCTGTAGGTCCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-2250s1c1
Sequence:CCGGAATCTAAGAGAGCTGCCATCGCTCGAGCGATGGCAGCTCTCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-2097s1c1
Sequence:CCGGAGAGGAAGCCTCTGGAAGTTCCTCGAGGAACTTCCAGAGGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-185s21c1
Sequence:CCGGCGTGGGCTTTACCATGAGTAACTCGAGTTACTCATGGTAAAGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000288700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021141.3-1368s21c1
Sequence:CCGGCCTCATATCAAGCATAACTATCTCGAGATAGTTATGCTTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-2204s21c1
Sequence:CCGGAGAGGAAGCCTCTGGAAGTTCCTCGAGGAACTTCCAGAGGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-2357s21c1
Sequence:CCGGAATCTAAGAGAGCTGCCATCGCTCGAGCGATGGCAGCTCTCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021141
VALIDATED
XRCC5 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000039838    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021141.2-2571s1c1
Sequence:CCGGGCAGCCCTTGTGATGTGATTACTCGAGTAATCACATCACAAGGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039842    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-78s1c1
Sequence:CCGGCGTGGGCTTTACCATGAGTAACTCGAGTTACTCATGGTAAAGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039841    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-1261s1c1
Sequence:CCGGCCTCATATCAAGCATAACTATCTCGAGATAGTTATGCTTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039840    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021141.2-513s1c1
Sequence:CCGGCCTGCAATTCTTCTTGCCTTTCTCGAGAAAGGCAAGAAGAATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039839    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.2-1993s1c1
Sequence:CCGGCGCTTTAACAACTTCCTGAAACTCGAGTTTCAGGAAGTTGTTAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010467    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-1707s1c1
Sequence:CCGGTGAAGATGGACCTACAGCTAACTCGAGTTAGCTGTAGGTCCATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010468    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-2250s1c1
Sequence:CCGGAATCTAAGAGAGCTGCCATCGCTCGAGCGATGGCAGCTCTCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018363    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_021141.x-2097s1c1
Sequence:CCGGAGAGGAAGCCTCTGGAAGTTCCTCGAGGAACTTCCAGAGGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288701    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-185s21c1
Sequence:CCGGCGTGGGCTTTACCATGAGTAACTCGAGTTACTCATGGTAAAGCCCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000288700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021141.3-1368s21c1
Sequence:CCGGCCTCATATCAAGCATAACTATCTCGAGATAGTTATGCTTGATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-2204s21c1
Sequence:CCGGAGAGGAAGCCTCTGGAAGTTCCTCGAGGAACTTCCAGAGGCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_021141.3-2357s21c1
Sequence:CCGGAATCTAAGAGAGCTGCCATCGCTCGAGCGATGGCAGCTCTCTTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009533
VALIDATED
XRCC5 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009533.1-357s1c1
Sequence:CCGGCCTGATTGTGTGCATGGATTTCTCGAGAAATCCATGCACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-975s1c1
Sequence:CCGGCGGAAGTGATATCATTCCTTTCTCGAGAAAGGAATGATATCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-2203s1c1
Sequence:CCGGGATGATTTACTGGACATGATACTCGAGTATCATGTCCAGTAAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-1616s1c1
Sequence:CCGGCCCTTAAAGTAAAGACCCTTTCTCGAGAAAGGGTCTTTACTTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-1203s1c1
Sequence:CCGGCGTCCGATATGCTTATGACAACTCGAGTTGTCATAAGCATATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-247s21c1
Sequence:CCGGTTTGTCCAACGACAGGTATTTCTCGAGAAATACCTGTCGTTGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-557s21c1
Sequence:CCGGAGGACCAACTGGACGTTATAACTCGAGTTATAACGTCCAGTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-818s21c1
Sequence:CCGGTACGACAACTGTGCGTCTTTACTCGAGTAAAGACGCACAGTTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-456s21c1
Sequence:CCGGCCTGATTGTGTGCATGGATTTCTCGAGAAATCCATGCACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009533.2-1070s21c1
Sequence:CCGGGCTACGGAAGTGATATCATTCCTCGAGGAATGATATCACTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009533
VALIDATED
XRCC5 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009533.1-357s1c1
Sequence:CCGGCCTGATTGTGTGCATGGATTTCTCGAGAAATCCATGCACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-975s1c1
Sequence:CCGGCGGAAGTGATATCATTCCTTTCTCGAGAAAGGAATGATATCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-2203s1c1
Sequence:CCGGGATGATTTACTGGACATGATACTCGAGTATCATGTCCAGTAAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-1616s1c1
Sequence:CCGGCCCTTAAAGTAAAGACCCTTTCTCGAGAAAGGGTCTTTACTTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-1203s1c1
Sequence:CCGGCGTCCGATATGCTTATGACAACTCGAGTTGTCATAAGCATATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-247s21c1
Sequence:CCGGTTTGTCCAACGACAGGTATTTCTCGAGAAATACCTGTCGTTGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-557s21c1
Sequence:CCGGAGGACCAACTGGACGTTATAACTCGAGTTATAACGTCCAGTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-818s21c1
Sequence:CCGGTACGACAACTGTGCGTCTTTACTCGAGTAAAGACGCACAGTTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-456s21c1
Sequence:CCGGCCTGATTGTGTGCATGGATTTCTCGAGAAATCCATGCACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009533.2-1070s21c1
Sequence:CCGGGCTACGGAAGTGATATCATTCCTCGAGGAATGATATCACTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009533
VALIDATED
XRCC5 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 5 (double-strand-break rejoining)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009533.1-357s1c1
Sequence:CCGGCCTGATTGTGTGCATGGATTTCTCGAGAAATCCATGCACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-975s1c1
Sequence:CCGGCGGAAGTGATATCATTCCTTTCTCGAGAAAGGAATGATATCACTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-2203s1c1
Sequence:CCGGGATGATTTACTGGACATGATACTCGAGTATCATGTCCAGTAAATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-1616s1c1
Sequence:CCGGCCCTTAAAGTAAAGACCCTTTCTCGAGAAAGGGTCTTTACTTTAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009533.1-1203s1c1
Sequence:CCGGCGTCCGATATGCTTATGACAACTCGAGTTGTCATAAGCATATCGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-247s21c1
Sequence:CCGGTTTGTCCAACGACAGGTATTTCTCGAGAAATACCTGTCGTTGGACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312882    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-557s21c1
Sequence:CCGGAGGACCAACTGGACGTTATAACTCGAGTTATAACGTCCAGTTGGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312877    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-818s21c1
Sequence:CCGGTACGACAACTGTGCGTCTTTACTCGAGTAAAGACGCACAGTTGTCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311823    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_009533.2-456s21c1
Sequence:CCGGCCTGATTGTGTGCATGGATTTCTCGAGAAATCCATGCACACAATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009533.2-1070s21c1
Sequence:CCGGGCTACGGAAGTGATATCATTCCTCGAGGAATGATATCACTTCCGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks