EMAIL THIS PAGE TO A FRIEND

XRCC6

X-ray repair complementing defective repair in Chinese hamster cells 6

Synonyms: CTC75 CTCBF G22P1 KU70 ML8 TLAA
UniProtKB ID: P12956, Q6FG89, Q9UCQ2, Q9UCQ3
Gene ID:
Human(2547) Summary: The p70/p80 autoantigen is a nuclear complex consisting of two subunits with molecular masses of approximately 70 and 80 kDa. The complex functions as a single-stranded DNA-dependent ATP-dependent helicase. The complex may be involved in the repair of nonhomologous DNA ends such as that required for double-strand break repair, transposition, and V(D)J recombination. High levels of autoantibodies to p70 and p80 have been found in some patients with systemic lupus erythematosus. [provided by RefSeq, Jul 2008]
Mouse(14375) X-ray repair complementing defective repair in Chinese hamster cells 6
Rat(25019) X-ray repair complementing defective repair in Chinese hamster cells 6
Zebrafish(334488) X-ray repair complementing defective repair in Chinese hamster cells 6
Horse(100070684) X-ray repair complementing defective repair in Chinese hamster cells 6
domestic cat(101081395) X-ray repair complementing defective repair in Chinese hamster cells 6
dog(474485) X-ray repair complementing defective repair in Chinese hamster cells 6
chicken(395767) X-ray repair complementing defective repair in Chinese hamster cells 6
Domestic Rabbit(100351956) X-ray repair complementing defective repair in Chinese hamster cells 6
naked mole-rat(101703462) X-ray repair complementing defective repair in Chinese hamster cells 6
domestic guinea pig(100717277) X-ray repair complementing defective repair in Chinese hamster cells 6
cow(510132) X-ray repair complementing defective repair in Chinese hamster cells 6
sheep(101112125) X-ray repair complementing defective repair in Chinese hamster cells 6
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34116 Anti-G22P1 (AB1) antibody produced in rabbit IgG fraction of antiserum human, bovine
western blot pricing
AV34117 Anti-G22P1 (AB2) antibody produced in rabbit IgG fraction of antiserum canine, mouse, rat, human, guinea pig, horse, rabbit
immunohistochemistry, western blot pricing
SAB1306517 ANTI-KU70 (CENTER) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing
K4763 Anti-Ku70 antibody produced in rabbit affinity isolated antibody, ammonium sulfate suspension human, rodent
immunohistochemistry, western blot pricing
SAB4501057 Anti-KU70, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human, rat
immunohistochemistry, western blot pricing
SAB4501056 Anti-KU70, N-Terminal antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2500578 Anti-KU70/XRCC6 antibody produced in goat affinity isolated antibody, buffered aqueous solution human
ELISA, western blot pricing
SAB4503890 Anti-phospho-Ku70 (pSer5) antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunohistochemistry, western blot pricing
HPA047549 Anti-XRCC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA062226 Anti-XRCC6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB4501058 Anti-XRCC6, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing
WH0002547M1 Monoclonal Anti-XRCC6 antibody produced in mouse clone 4C2-1A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1403847 Monoclonal Anti-XRCC6 antibody produced in mouse clone 3D12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
PLA0263 Rabbit anti-Ku70 Antibody, Affinity Purified Powered by Bethyl Laboratories, Inc. human, marmoset, primate, chimpanzee, gorilla, rhesus monkey
immunofluorescence, immunohistochemistry, immunoprecipitation, proximity ligation assay, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001469 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001469 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001469 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010247 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010247 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010247 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001469 Rosetta Predictions human pricing
NM_139080 Rosetta Predictions rat pricing
NM_010247 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001469 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070122 predicted 457
2 SASI_Hs02_00331917 predicted 322
3 SASI_Hs02_00331918 predicted 308
4 SASI_Hs01_00070121 predicted 1605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139080 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00268427 predicted 1093
2 SASI_Rn01_00086415 predicted 219
3 SASI_Rn02_00268428 predicted 1270
4 SASI_Rn02_00268429 predicted 275
5 SASI_Rn01_00086417 predicted 541
6 SASI_Rn02_00268430 predicted 1107
7 SASI_Rn01_00086418 predicted 571
8 SASI_Rn02_00268431 predicted 1415
9 SASI_Rn02_00268432 predicted 399
10 SASI_Rn01_00086422 predicted 330
11 SASI_Rn01_00086416 predicted 878
12 SASI_Rn01_00086419 predicted 408
13 SASI_Rn01_00086420 predicted 546
14 SASI_Rn01_00086421 predicted 1241
15 SASI_Rn01_00086423 predicted 686
16 SASI_Rn01_00086424 predicted 461
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010247 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022755 predicted 871
2 SASI_Mm01_00022756 predicted 251
3 SASI_Mm01_00022757 predicted 1843
4 SASI_Mm01_00022758 predicted 1123
5 SASI_Mm01_00022759 predicted 600
6 SASI_Mm01_00022760 predicted 924
7 SASI_Mm01_00022761 predicted 1134
8 SASI_Mm01_00022762 predicted 589
9 SASI_Mm01_00022763 predicted 582
10 SASI_Mm02_00318136 predicted 1454
11 SASI_Mm01_00022764 predicted 1918
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001469
VALIDATED
XRCC6 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 6
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001469.3-1993s21c1
Sequence:CCGGGAAGAGTCTACCCGACATAAGCTCGAGCTTATGTCGGGTAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-550s21c1
Sequence:CCGGGATGAGTCATAAGAGGATCATCTCGAGATGATCCTCTTATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-1595s21c1
Sequence:CCGGCCCAAGGTTGAAGCAATGAATCTCGAGATTCATTGCTTCAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-1043s21c1
Sequence:CCGGCGTCAGATTATACTGGAGAAACTCGAGTTTCTCCAGTATAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.x-2068s1c1
Sequence:CCGGCACATACAGAAGTGACAGCTTCTCGAGAAGCTGTCACTTCTGTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.x-2578s1c1
Sequence:CCGGAAGAGTCTACCCGACATAAGCTCGAGCTTATGTCGGGTAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001469.2-2590s1c1
Sequence:CCGGCGACATAAGTCGAGGGACTTTCTCGAGAAAGTCCCTCGACTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.2-1135s1c1
Sequence:CCGGGATGAGTCATAAGAGGATCATCTCGAGATGATCCTCTTATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.2-1628s1c1
Sequence:CCGGCGTCAGATTATACTGGAGAAACTCGAGTTTCTCCAGTATAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001469
VALIDATED
XRCC6 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 6
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001469.3-1993s21c1
Sequence:CCGGGAAGAGTCTACCCGACATAAGCTCGAGCTTATGTCGGGTAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-550s21c1
Sequence:CCGGGATGAGTCATAAGAGGATCATCTCGAGATGATCCTCTTATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-1595s21c1
Sequence:CCGGCCCAAGGTTGAAGCAATGAATCTCGAGATTCATTGCTTCAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-1043s21c1
Sequence:CCGGCGTCAGATTATACTGGAGAAACTCGAGTTTCTCCAGTATAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.x-2068s1c1
Sequence:CCGGCACATACAGAAGTGACAGCTTCTCGAGAAGCTGTCACTTCTGTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.x-2578s1c1
Sequence:CCGGAAGAGTCTACCCGACATAAGCTCGAGCTTATGTCGGGTAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001469.2-2590s1c1
Sequence:CCGGCGACATAAGTCGAGGGACTTTCTCGAGAAAGTCCCTCGACTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.2-1135s1c1
Sequence:CCGGGATGAGTCATAAGAGGATCATCTCGAGATGATCCTCTTATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.2-1628s1c1
Sequence:CCGGCGTCAGATTATACTGGAGAAACTCGAGTTTCTCCAGTATAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001469
VALIDATED
XRCC6 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 6
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353003    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001469.3-1993s21c1
Sequence:CCGGGAAGAGTCTACCCGACATAAGCTCGAGCTTATGTCGGGTAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332901    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-550s21c1
Sequence:CCGGGATGAGTCATAAGAGGATCATCTCGAGATGATCCTCTTATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332902    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-1595s21c1
Sequence:CCGGCCCAAGGTTGAAGCAATGAATCTCGAGATTCATTGCTTCAACCTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332966    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001469.3-1043s21c1
Sequence:CCGGCGTCAGATTATACTGGAGAAACTCGAGTTTCTCCAGTATAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010371    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.x-2068s1c1
Sequence:CCGGCACATACAGAAGTGACAGCTTCTCGAGAAGCTGTCACTTCTGTATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009846    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.x-2578s1c1
Sequence:CCGGAAGAGTCTACCCGACATAAGCTCGAGCTTATGTCGGGTAGACTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001469.2-2590s1c1
Sequence:CCGGCGACATAAGTCGAGGGACTTTCTCGAGAAAGTCCCTCGACTTATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.2-1135s1c1
Sequence:CCGGGATGAGTCATAAGAGGATCATCTCGAGATGATCCTCTTATGACTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001469.2-1628s1c1
Sequence:CCGGCGTCAGATTATACTGGAGAAACTCGAGTTTCTCCAGTATAATCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010247
VALIDATED
XRCC6 MISSION shRNA Bacterial Glycerol Stock
X-ray repair complementing defective repair in Chinese hamster cells 6
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000321228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-461s21c1
Sequence:CCGGTGCTAGAGCTCGACCAGTTTACTCGAGTAAACTGGTCGAGCTCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-1839s21c1
Sequence:CCGGGCTCACTGTACCTACACTGAACTCGAGTTCAGTGTAGGTACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000321294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-185s21c1
Sequence:CCGGCCGACACAGGTGGAGAATATACTCGAGTATATTCTCCACCTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-1952s21c1
Sequence:CCGGAGCTCAGAAGCCCAGCCACTTCTCGAGAAGTGGCTGGGCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-2021s1c1
Sequence:CCGGAGCTCAGAAGCCCAGCCACTTCTCGAGAAGTGGCTGGGCTTCTGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1156s1c1
Sequence:CCGGCGTCAGATTGTGCTGGAGAAACTCGAGTTTCTCCAGCACAATCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1908s1c1
Sequence:CCGGGCTCACTGTACCTACACTGAACTCGAGTTCAGTGTAGGTACAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1747s1c1
Sequence:CCGGGCAGATGAGTTTAAAGAACTTCTCGAGAAGTTCTTTAAACTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-254s1c1
Sequence:CCGGCCGACACAGGTGGAGAATATACTCGAGTATATTCTCCACCTGTGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010247
VALIDATED
XRCC6 MISSION shRNA shRNA Plasmid DNA
X-ray repair complementing defective repair in Chinese hamster cells 6
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000321228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-461s21c1
Sequence:CCGGTGCTAGAGCTCGACCAGTTTACTCGAGTAAACTGGTCGAGCTCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-1839s21c1
Sequence:CCGGGCTCACTGTACCTACACTGAACTCGAGTTCAGTGTAGGTACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000321294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-185s21c1
Sequence:CCGGCCGACACAGGTGGAGAATATACTCGAGTATATTCTCCACCTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-1952s21c1
Sequence:CCGGAGCTCAGAAGCCCAGCCACTTCTCGAGAAGTGGCTGGGCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-2021s1c1
Sequence:CCGGAGCTCAGAAGCCCAGCCACTTCTCGAGAAGTGGCTGGGCTTCTGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1156s1c1
Sequence:CCGGCGTCAGATTGTGCTGGAGAAACTCGAGTTTCTCCAGCACAATCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1908s1c1
Sequence:CCGGGCTCACTGTACCTACACTGAACTCGAGTTCAGTGTAGGTACAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1747s1c1
Sequence:CCGGGCAGATGAGTTTAAAGAACTTCTCGAGAAGTTCTTTAAACTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-254s1c1
Sequence:CCGGCCGACACAGGTGGAGAATATACTCGAGTATATTCTCCACCTGTGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010247
VALIDATED
XRCC6 MISSION shRNA Lentiviral Transduction Particles
X-ray repair complementing defective repair in Chinese hamster cells 6
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000321228    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-461s21c1
Sequence:CCGGTGCTAGAGCTCGACCAGTTTACTCGAGTAAACTGGTCGAGCTCTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-1839s21c1
Sequence:CCGGGCTCACTGTACCTACACTGAACTCGAGTTCAGTGTAGGTACAGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000321294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-185s21c1
Sequence:CCGGCCGACACAGGTGGAGAATATACTCGAGTATATTCTCCACCTGTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350563    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_010247.2-1952s21c1
Sequence:CCGGAGCTCAGAAGCCCAGCCACTTCTCGAGAAGTGGCTGGGCTTCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012218    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-2021s1c1
Sequence:CCGGAGCTCAGAAGCCCAGCCACTTCTCGAGAAGTGGCTGGGCTTCTGAGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012219    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1156s1c1
Sequence:CCGGCGTCAGATTGTGCTGGAGAAACTCGAGTTTCTCCAGCACAATCTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012221    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1908s1c1
Sequence:CCGGGCTCACTGTACCTACACTGAACTCGAGTTCAGTGTAGGTACAGTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-1747s1c1
Sequence:CCGGGCAGATGAGTTTAAAGAACTTCTCGAGAAGTTCTTTAAACTCATCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010247.1-254s1c1
Sequence:CCGGCCGACACAGGTGGAGAATATACTCGAGTATATTCTCCACCTGTGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks