EMAIL THIS PAGE TO A FRIEND

XRCC6BP1

XRCC6 binding protein 1

Synonyms: KUB3
UniProtKB ID: Q9Y6H3, Q1RLM4, Q96E81
Gene ID:
Mouse(68876) XRCC6 binding protein 1
Rat(299828) XRCC6 binding protein 1
cow(514014) XRCC6 binding protein 1
sheep(101118866) XRCC6 binding protein 1
domestic guinea pig(100716008) XRCC6 binding protein 1
naked mole-rat(101696938) XRCC6 binding protein 1
Zebrafish(100004177) XRCC6 binding protein 1
chicken(417812) XRCC6 binding protein 1
domestic cat(101083350) XRCC6 binding protein 1
dog(474422) XRCC6 binding protein 1
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033276 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033276 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033276 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026858 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026858 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026858 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033276 Rosetta Predictions human pricing
NM_001134466 Rosetta Predictions rat pricing
NM_026858 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033276 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084164 predicted 405
2 SASI_Hs01_00084165 predicted 416
3 SASI_Hs01_00084166 predicted 491
4 SASI_Hs01_00084167 predicted 395
5 SASI_Hs01_00084169 predicted 453
6 SASI_Hs01_00084170 predicted 533
7 SASI_Hs01_00084171 predicted 446
8 SASI_Hs01_00084172 predicted 567
9 SASI_Hs01_00084173 predicted 470
10 SASI_Hs02_00361080 predicted 453
11 SASI_Hs01_00084168 predicted 454
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134466 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256389 predicted 757
2 SASI_Rn02_00256390 predicted 614
3 SASI_Rn02_00256391 predicted 384
4 SASI_Rn02_00256392 predicted 592
5 SASI_Rn02_00256393 predicted 254
6 SASI_Rn02_00256394 predicted 413
7 SASI_Rn02_00256395 predicted 241
8 SASI_Rn02_00256396 predicted 824
9 SASI_Rn02_00256397 predicted 262
10 SASI_Rn02_00256398 predicted 845
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026858 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00100058 predicted 249
2 SASI_Mm01_00100059 predicted 473
3 SASI_Mm01_00100060 predicted 208
4 SASI_Mm01_00100061 predicted 383
5 SASI_Mm01_00100062 predicted 544
6 SASI_Mm01_00100063 predicted 364
7 SASI_Mm01_00100064 predicted 350
8 SASI_Mm01_00100065 predicted 605
9 SASI_Mm01_00100066 predicted 348
10 SASI_Mm01_00100067 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033276
VALIDATED
XRCC6BP1 MISSION shRNA Bacterial Glycerol Stock
XRCC6 binding protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000136198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_033276.1-263s1c1
Sequence:CCGGGCTATGAAACACTCAGGTTGTCTCGAGACAACCTGAGTGTTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-684s1c1
Sequence:CCGGGTTTCAATGACCATGAACCTTCTCGAGAAGGTTCATGGTCATTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-350s1c1
Sequence:CCGGGCTTCAACATCTCAGATAGTTCTCGAGAACTATCTGAGATGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-763s1c1
Sequence:CCGGCCGTGATCGGTATTATTCAAACTCGAGTTTGAATAATACCGATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033276.1-527s1c1
Sequence:CCGGGACTGCTCACTTGTCAATGAACTCGAGTTCATTGACAAGTGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033276.2-365s21c1
Sequence:CCGGTGCCAGAATAATATCCATAATCTCGAGATTATGGATATTATTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000359024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033276.2-901s21c1
Sequence:CCGGGACTGTGATTCTAGCATATTACTCGAGTAATATGCTAGAATCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033276.2-405s21c1
Sequence:CCGGTGGTCACACACGAGCTTATTCCTCGAGGAATAAGCTCGTGTGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_033276.2-626s21c1
Sequence:CCGGATCAGCAAAGAAGTAGCTAAACTCGAGTTTAGCTACTTCTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033276
VALIDATED
XRCC6BP1 MISSION shRNA shRNA Plasmid DNA
XRCC6 binding protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000136198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_033276.1-263s1c1
Sequence:CCGGGCTATGAAACACTCAGGTTGTCTCGAGACAACCTGAGTGTTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-684s1c1
Sequence:CCGGGTTTCAATGACCATGAACCTTCTCGAGAAGGTTCATGGTCATTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-350s1c1
Sequence:CCGGGCTTCAACATCTCAGATAGTTCTCGAGAACTATCTGAGATGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-763s1c1
Sequence:CCGGCCGTGATCGGTATTATTCAAACTCGAGTTTGAATAATACCGATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033276.1-527s1c1
Sequence:CCGGGACTGCTCACTTGTCAATGAACTCGAGTTCATTGACAAGTGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033276.2-365s21c1
Sequence:CCGGTGCCAGAATAATATCCATAATCTCGAGATTATGGATATTATTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000359024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033276.2-901s21c1
Sequence:CCGGGACTGTGATTCTAGCATATTACTCGAGTAATATGCTAGAATCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033276.2-405s21c1
Sequence:CCGGTGGTCACACACGAGCTTATTCCTCGAGGAATAAGCTCGTGTGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_033276.2-626s21c1
Sequence:CCGGATCAGCAAAGAAGTAGCTAAACTCGAGTTTAGCTACTTCTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033276
VALIDATED
XRCC6BP1 MISSION shRNA Lentiviral Transduction Particles
XRCC6 binding protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000136198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_033276.1-263s1c1
Sequence:CCGGGCTATGAAACACTCAGGTTGTCTCGAGACAACCTGAGTGTTTCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-684s1c1
Sequence:CCGGGTTTCAATGACCATGAACCTTCTCGAGAAGGTTCATGGTCATTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-350s1c1
Sequence:CCGGGCTTCAACATCTCAGATAGTTCTCGAGAACTATCTGAGATGTTGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_033276.1-763s1c1
Sequence:CCGGCCGTGATCGGTATTATTCAAACTCGAGTTTGAATAATACCGATCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_033276.1-527s1c1
Sequence:CCGGGACTGCTCACTTGTCAATGAACTCGAGTTCATTGACAAGTGAGCAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359023    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033276.2-365s21c1
Sequence:CCGGTGCCAGAATAATATCCATAATCTCGAGATTATGGATATTATTCTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000359024    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_033276.2-901s21c1
Sequence:CCGGGACTGTGATTCTAGCATATTACTCGAGTAATATGCTAGAATCACAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358942    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033276.2-405s21c1
Sequence:CCGGTGGTCACACACGAGCTTATTCCTCGAGGAATAAGCTCGTGTGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 2 Clone ID:NM_033276.2-626s21c1
Sequence:CCGGATCAGCAAAGAAGTAGCTAAACTCGAGTTTAGCTACTTCTTTGCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026858
VALIDATED
XRCC6BP1 MISSION shRNA Bacterial Glycerol Stock
XRCC6 binding protein 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000180195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026858.2-393s1c1
Sequence:CCGGCGAGAATAACATCCGGAATCACTCGAGTGATTCCGGATGTTATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026858.2-601s1c1
Sequence:CCGGCAGATAGAGACTAGCTGTGTACTCGAGTACACAGCTAGTCTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026858.2-734s1c1
Sequence:CCGGCCATCATGGTCTGACTGTTATCTCGAGATAACAGTCAGACCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026858.2-666s21c1
Sequence:CCGGTGCGTAGACAGCAGGCATAACCTCGAGGTTATGCCTGCTGTCTACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026858.2-269s21c1
Sequence:CCGGTTCTACTTGATGCTATGAAACCTCGAGGTTTCATAGCATCAAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026858.2-392s21c1
Sequence:CCGGGCGAGAATAACATCCGGAATCCTCGAGGATTCCGGATGTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026858.2-440s21c1
Sequence:CCGGACGAGCTCATTCACGCGTTTGCTCGAGCAAACGCGTGAATGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026858
VALIDATED
XRCC6BP1 MISSION shRNA shRNA Plasmid DNA
XRCC6 binding protein 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000180195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026858.2-393s1c1
Sequence:CCGGCGAGAATAACATCCGGAATCACTCGAGTGATTCCGGATGTTATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026858.2-601s1c1
Sequence:CCGGCAGATAGAGACTAGCTGTGTACTCGAGTACACAGCTAGTCTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026858.2-734s1c1
Sequence:CCGGCCATCATGGTCTGACTGTTATCTCGAGATAACAGTCAGACCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026858.2-666s21c1
Sequence:CCGGTGCGTAGACAGCAGGCATAACCTCGAGGTTATGCCTGCTGTCTACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026858.2-269s21c1
Sequence:CCGGTTCTACTTGATGCTATGAAACCTCGAGGTTTCATAGCATCAAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026858.2-392s21c1
Sequence:CCGGGCGAGAATAACATCCGGAATCCTCGAGGATTCCGGATGTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026858.2-440s21c1
Sequence:CCGGACGAGCTCATTCACGCGTTTGCTCGAGCAAACGCGTGAATGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026858
VALIDATED
XRCC6BP1 MISSION shRNA Lentiviral Transduction Particles
XRCC6 binding protein 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000180195    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026858.2-393s1c1
Sequence:CCGGCGAGAATAACATCCGGAATCACTCGAGTGATTCCGGATGTTATTCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180196    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_026858.2-601s1c1
Sequence:CCGGCAGATAGAGACTAGCTGTGTACTCGAGTACACAGCTAGTCTCTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180168    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026858.2-734s1c1
Sequence:CCGGCCATCATGGTCTGACTGTTATCTCGAGATAACAGTCAGACCATGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247446    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026858.2-666s21c1
Sequence:CCGGTGCGTAGACAGCAGGCATAACCTCGAGGTTATGCCTGCTGTCTACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247445    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026858.2-269s21c1
Sequence:CCGGTTCTACTTGATGCTATGAAACCTCGAGGTTTCATAGCATCAAGTAGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257769    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026858.2-392s21c1
Sequence:CCGGGCGAGAATAACATCCGGAATCCTCGAGGATTCCGGATGTTATTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026858.2-440s21c1
Sequence:CCGGACGAGCTCATTCACGCGTTTGCTCGAGCAAACGCGTGAATGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks