EMAIL THIS PAGE TO A FRIEND

XRN1

5'-3' exoribonuclease 1

Synonyms: SEP1
Gene ID:
Human(54464) Summary: SEP1 localizes to cytoplasmic foci containing a complex of mRNA-degrading enzymes. In addition to mRNA metabolism, yeast Sep1 has been implicated in a variety of nuclear and cytoplasmic functions, including homologous recombination, meiosis, telomere maintenance, and microtubule assembly.[supplied by OMIM, Apr 2004]
Mouse(24127) 5'-3' exoribonuclease 1
Rat(300944) 5'-3' exoribonuclease 1
Zebrafish(394008) 5'-3' exoribonuclease 1
domestic cat(101097088) 5'-3' exoribonuclease 1
Horse(100051335) 5'-3' exoribonuclease 1
dog(477100) 5'-3' exoribonuclease 1
chicken(424778) 5'-3' exoribonuclease 1
naked mole-rat(101701152) 5'-3' exoribonuclease 1
Domestic Rabbit(100351589) 5'-3' exoribonuclease 1
domestic guinea pig(100732416) 5'-3' exoribonuclease 1
cow(540834) 5'-3' exoribonuclease 1
sheep(101106821) 5'-3' exoribonuclease 1
250 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011916 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011916 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011916 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019001 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019001 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019001 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042604 Rosetta Predictions human pricing
NM_019001 Rosetta Predictions human pricing
XM_001069029 Rosetta Predictions rat pricing
XM_217233 Rosetta Predictions rat pricing
NM_011916 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042604 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310788 predicted 4391
2 SASI_Hs02_00310789 predicted 1366
3 SASI_Hs02_00310790 predicted 3606
4 SASI_Hs02_00310791 predicted 1543
5 SASI_Hs02_00310792 predicted 3499
6 SASI_Hs02_00310793 predicted 4002
7 SASI_Hs02_00310794 predicted 673
8 SASI_Hs02_00310795 predicted 4325
9 SASI_Hs02_00310796 predicted 3014
10 SASI_Hs02_00310797 predicted 2657
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019001 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00212296 predicted 4391
2 SASI_Hs01_00212298 predicted 1365
3 SASI_Hs01_00212299 predicted 3614
4 SASI_Hs01_00212300 predicted 1534
5 SASI_Hs01_00212301 predicted 3504
6 SASI_Hs01_00212302 predicted 4002
7 SASI_Hs01_00212303 predicted 672
8 SASI_Hs01_00212304 predicted 4331
9 SASI_Hs01_00212305 predicted 3013
10 SASI_Hs02_00352512 predicted 2659
11 SASI_Hs01_00212297 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00326668 predicted 3554
2 SASI_Rn02_00326669 predicted 244
3 SASI_Rn02_00326670 predicted 3379
4 SASI_Rn02_00326671 predicted 1506
5 SASI_Rn02_00326672 predicted 4646
6 SASI_Rn02_00326673 predicted 3637
7 SASI_Rn02_00326674 predicted 1193
8 SASI_Rn02_00326675 predicted 1526
9 SASI_Rn02_00326676 predicted 1444
10 SASI_Rn02_00326677 predicted 2574
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_217233 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377080 predicted 246
2 SASI_Rn02_00377081 predicted 2664
3 SASI_Rn02_00377082 predicted 1501
4 SASI_Rn02_00377083 predicted 2416
5 SASI_Rn02_00377084 predicted 374
6 SASI_Rn02_00377085 predicted 1187
7 SASI_Rn02_00377086 predicted 1538
8 SASI_Rn02_00377087 predicted 1136
9 SASI_Rn02_00377088 predicted 1532
10 SASI_Rn02_00377089 predicted 1453
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011916 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00154570 predicted 1473
2 SASI_Mm01_00154571 predicted 3991
3 SASI_Mm01_00154572 predicted 2529
4 SASI_Mm01_00154573 predicted 3886
5 SASI_Mm01_00154574 predicted 2874
6 SASI_Mm02_00321740 predicted 204
7 SASI_Mm02_00321741 predicted 2628
8 SASI_Mm01_00154576 predicted 2675
9 SASI_Mm01_00154577 predicted 4810
10 SASI_Mm01_00154578 predicted 3796
11 SASI_Mm01_00154569 predicted 3442
12 SASI_Mm01_00154575 predicted 230
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011916
VALIDATED
XRN1 MISSION shRNA Bacterial Glycerol Stock
5'-3' exoribonuclease 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000375261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-1796s21c1
Sequence:CCGGGTGGTATTAATACCGTTTATTCTCGAGAATAAACGGTATTAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-5334s21c1
Sequence:CCGGTGATATCTATGTGTCAGAAATCTCGAGATTTCTGACACATAGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-4812s21c1
Sequence:CCGGCCCAACCTACTGCTAATATAACTCGAGTTATATTAGCAGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-2086s21c1
Sequence:CCGGCCCTACTTTGAAACACATCAACTCGAGTTGATGTGTTTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011916.2-1979s21c1
Sequence:CCGGCGATGTTGTACAAGGTATAAACTCGAGTTTATACCTTGTACAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-921s1c1
Sequence:CCGGGCCTCTTCTTTATGGAACATACTCGAGTATGTTCCATAAAGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011916.1-4703s1c1
Sequence:CCGGCCCAACCTACTGCTAATATAACTCGAGTTATATTAGCAGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1978s1c1
Sequence:CCGGCCTACTTTGAAACACATCAAACTCGAGTTTGATGTGTTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1369s1c1
Sequence:CCGGGCCTGTTATGTTCAGGCTATACTCGAGTATAGCCTGAACATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1977s1c1
Sequence:CCGGCCCTACTTTGAAACACATCAACTCGAGTTGATGTGTTTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011916
VALIDATED
XRN1 MISSION shRNA shRNA Plasmid DNA
5'-3' exoribonuclease 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000375261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-1796s21c1
Sequence:CCGGGTGGTATTAATACCGTTTATTCTCGAGAATAAACGGTATTAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-5334s21c1
Sequence:CCGGTGATATCTATGTGTCAGAAATCTCGAGATTTCTGACACATAGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-4812s21c1
Sequence:CCGGCCCAACCTACTGCTAATATAACTCGAGTTATATTAGCAGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-2086s21c1
Sequence:CCGGCCCTACTTTGAAACACATCAACTCGAGTTGATGTGTTTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011916.2-1979s21c1
Sequence:CCGGCGATGTTGTACAAGGTATAAACTCGAGTTTATACCTTGTACAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-921s1c1
Sequence:CCGGGCCTCTTCTTTATGGAACATACTCGAGTATGTTCCATAAAGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011916.1-4703s1c1
Sequence:CCGGCCCAACCTACTGCTAATATAACTCGAGTTATATTAGCAGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1978s1c1
Sequence:CCGGCCTACTTTGAAACACATCAAACTCGAGTTTGATGTGTTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1369s1c1
Sequence:CCGGGCCTGTTATGTTCAGGCTATACTCGAGTATAGCCTGAACATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1977s1c1
Sequence:CCGGCCCTACTTTGAAACACATCAACTCGAGTTGATGTGTTTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011916
VALIDATED
XRN1 MISSION shRNA Lentiviral Transduction Particles
5'-3' exoribonuclease 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000375261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-1796s21c1
Sequence:CCGGGTGGTATTAATACCGTTTATTCTCGAGAATAAACGGTATTAATACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375194    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-5334s21c1
Sequence:CCGGTGATATCTATGTGTCAGAAATCTCGAGATTTCTGACACATAGATATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328996    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-4812s21c1
Sequence:CCGGCCCAACCTACTGCTAATATAACTCGAGTTATATTAGCAGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329056    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011916.2-2086s21c1
Sequence:CCGGCCCTACTTTGAAACACATCAACTCGAGTTGATGTGTTTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329112    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011916.2-1979s21c1
Sequence:CCGGCGATGTTGTACAAGGTATAAACTCGAGTTTATACCTTGTACAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-921s1c1
Sequence:CCGGGCCTCTTCTTTATGGAACATACTCGAGTATGTTCCATAAAGAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119945    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011916.1-4703s1c1
Sequence:CCGGCCCAACCTACTGCTAATATAACTCGAGTTATATTAGCAGTAGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1978s1c1
Sequence:CCGGCCTACTTTGAAACACATCAAACTCGAGTTTGATGTGTTTCAAAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1369s1c1
Sequence:CCGGGCCTGTTATGTTCAGGCTATACTCGAGTATAGCCTGAACATAACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011916.1-1977s1c1
Sequence:CCGGCCCTACTTTGAAACACATCAACTCGAGTTGATGTGTTTCAAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019001
VALIDATED
XRN1 MISSION shRNA Bacterial Glycerol Stock
5'-3' exoribonuclease 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019001.3-2750s21c1
Sequence:CCGGCCCAATCTTGATGCTTTAATACTCGAGTATTAAAGCATCAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-5574s21c1
Sequence:CCGGACACTATCATTGAGGAATAATCTCGAGATTATTCCTCAATGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019001.3-1771s21c1
Sequence:CCGGTATTGATGAGAAGCGATTATTCTCGAGAATAATCGCTTCTCATCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-1937s21c1
Sequence:CCGGCGATGTTGTACAAGGTATAAACTCGAGTTTATACCTTGTACAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-2464s21c1
Sequence:CCGGGTTACTCACAGGTCGTAAATACTCGAGTATTTACGACCTGTGAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019001.2-284s1c1
Sequence:CCGGCGCATTATTAAACCCAGGAAACTCGAGTTTCCTGGGTTTAATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-2750s1c1
Sequence:CCGGCCCAATCTTGATGCTTTAATACTCGAGTATTAAAGCATCAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-4969s1c1
Sequence:CCGGCCAGCCAGATTCTTCCAACATCTCGAGATGTTGGAAGAATCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-1500s1c1
Sequence:CCGGGCTGGTATTATCCTTATCATTCTCGAGAATGATAAGGATAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-3474s1c1
Sequence:CCGGCCGATGTACTATTTGAAGTATCTCGAGATACTTCAAATAGTACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019001
VALIDATED
XRN1 MISSION shRNA shRNA Plasmid DNA
5'-3' exoribonuclease 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019001.3-2750s21c1
Sequence:CCGGCCCAATCTTGATGCTTTAATACTCGAGTATTAAAGCATCAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-5574s21c1
Sequence:CCGGACACTATCATTGAGGAATAATCTCGAGATTATTCCTCAATGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019001.3-1771s21c1
Sequence:CCGGTATTGATGAGAAGCGATTATTCTCGAGAATAATCGCTTCTCATCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-1937s21c1
Sequence:CCGGCGATGTTGTACAAGGTATAAACTCGAGTTTATACCTTGTACAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-2464s21c1
Sequence:CCGGGTTACTCACAGGTCGTAAATACTCGAGTATTTACGACCTGTGAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019001.2-284s1c1
Sequence:CCGGCGCATTATTAAACCCAGGAAACTCGAGTTTCCTGGGTTTAATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-2750s1c1
Sequence:CCGGCCCAATCTTGATGCTTTAATACTCGAGTATTAAAGCATCAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-4969s1c1
Sequence:CCGGCCAGCCAGATTCTTCCAACATCTCGAGATGTTGGAAGAATCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-1500s1c1
Sequence:CCGGGCTGGTATTATCCTTATCATTCTCGAGAATGATAAGGATAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-3474s1c1
Sequence:CCGGCCGATGTACTATTTGAAGTATCTCGAGATACTTCAAATAGTACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019001
VALIDATED
XRN1 MISSION shRNA Lentiviral Transduction Particles
5'-3' exoribonuclease 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019001.3-2750s21c1
Sequence:CCGGCCCAATCTTGATGCTTTAATACTCGAGTATTAAAGCATCAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296760    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-5574s21c1
Sequence:CCGGACACTATCATTGAGGAATAATCTCGAGATTATTCCTCAATGATAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019001.3-1771s21c1
Sequence:CCGGTATTGATGAGAAGCGATTATTCTCGAGAATAATCGCTTCTCATCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-1937s21c1
Sequence:CCGGCGATGTTGTACAAGGTATAAACTCGAGTTTATACCTTGTACAACATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_019001.3-2464s21c1
Sequence:CCGGGTTACTCACAGGTCGTAAATACTCGAGTATTTACGACCTGTGAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019001.2-284s1c1
Sequence:CCGGCGCATTATTAAACCCAGGAAACTCGAGTTTCCTGGGTTTAATAATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-2750s1c1
Sequence:CCGGCCCAATCTTGATGCTTTAATACTCGAGTATTAAAGCATCAAGATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-4969s1c1
Sequence:CCGGCCAGCCAGATTCTTCCAACATCTCGAGATGTTGGAAGAATCTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-1500s1c1
Sequence:CCGGGCTGGTATTATCCTTATCATTCTCGAGAATGATAAGGATAATACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_019001.2-3474s1c1
Sequence:CCGGCCGATGTACTATTTGAAGTATCTCGAGATACTTCAAATAGTACATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks