EMAIL THIS PAGE TO A FRIEND

XRN2

5'-3' exoribonuclease 2

Gene ID:
Human(22803) Summary: This gene shares similarity with the mouse Dhm1 and the yeast dhp1 gene. The yeast gene is involved in homologous recombination and RNA metabolism, such as RNA synthesis and RNA trafficking. Complementation studies show that Dhm1 has a similar function in mouse as dhp1. The function of the human gene has not yet been determined. Transcript variants encoding different isoforms have been noted for this gene; however, their full-length nature is not known. [provided by RefSeq, Jul 2008]
Mouse(24128) 5'-3' exoribonuclease 2
Rat(362229) 5'-3' exoribonuclease 2
cow(517417) 5'-3' exoribonuclease 2
sheep(101102410) 5'-3' exoribonuclease 2
domestic guinea pig(100732138) 5'-3' exoribonuclease 2
Domestic Rabbit(100353161) 5'-3' exoribonuclease 2
naked mole-rat(101697198) 5'-3' exoribonuclease 2
Thale Cress(834261) 5'-3' exoribonuclease 2
Horse(100050094) 5'-3' exoribonuclease 2
Zebrafish(321940) 5'-3' exoribonuclease 2
chicken(421236) 5'-3' exoribonuclease 2
domestic cat(101084699) 5'-3' exoribonuclease 2
dog(477133) 5'-3' exoribonuclease 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012255 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012255 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012255 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011917 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011917 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011917 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012255 Rosetta Predictions human pricing
NM_001108596 Rosetta Predictions rat pricing
NM_011917 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012255 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190257 predicted 1143
2 SASI_Hs01_00190258 predicted 1254
3 SASI_Hs01_00190260 predicted 962
4 SASI_Hs01_00190261 predicted 1994
5 SASI_Hs01_00190262 predicted 2612
6 SASI_Hs02_00343966 predicted 1934
7 SASI_Hs01_00190263 predicted 2072
8 SASI_Hs01_00190264 predicted 952
9 SASI_Hs01_00190266 predicted 1081
10 SASI_Hs02_00343967 predicted 1511
11 SASI_Hs01_00190259 predicted 1866
12 SASI_Hs01_00190265 predicted 1656
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108596 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00240199 predicted 2999
2 SASI_Rn02_00240200 predicted 2578
3 SASI_Rn02_00240201 predicted 2664
4 SASI_Rn02_00240202 predicted 1722
5 SASI_Rn02_00240203 predicted 2965
6 SASI_Rn02_00240204 predicted 2837
7 SASI_Rn02_00240205 predicted 2351
8 SASI_Rn02_00240206 predicted 2020
9 SASI_Rn02_00240207 predicted 2306
10 SASI_Rn02_00240208 predicted 3077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011917 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00193520 predicted 1653
2 SASI_Mm01_00193521 predicted 1216
3 SASI_Mm01_00193522 predicted 1954
4 SASI_Mm01_00193523 predicted 1019
5 SASI_Mm02_00321742 predicted 1742
6 SASI_Mm01_00193525 predicted 282
7 SASI_Mm01_00193526 predicted 2186
8 SASI_Mm01_00193527 predicted 1237
9 SASI_Mm01_00193529 predicted 560
10 SASI_Mm02_00321743 predicted 2439
11 SASI_Mm01_00193524 predicted 1399
12 SASI_Mm01_00193528 predicted 1734
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012255
VALIDATED
XRN2 MISSION shRNA Bacterial Glycerol Stock
5'-3' exoribonuclease 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000049898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012255.2-810s1c1
Sequence:CCGGCCACACATGAACCGAACTTTACTCGAGTAAAGTTCGGTTCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-2218s1c1
Sequence:CCGGCCCTGAACTATGTCATGGGATCTCGAGATCCCATGACATAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-1598s1c1
Sequence:CCGGCCAGAGGATAATGTCAGGTTACTCGAGTAACCTGACATTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012255.2-1541s1c1
Sequence:CCGGCCGTCTCCATTAGGAGGAATTCTCGAGAATTCCTCCTAATGGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-1013s1c1
Sequence:CCGGCGTGAGTATTTGGAAAGAGAACTCGAGTTCTCTTTCCAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-820s21c1
Sequence:CCGGCCACACATGAACCGAACTTTACTCGAGTAAAGTTCGGTTCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-1952s21c1
Sequence:CCGGTGATCCTGATTCTAGTATAATCTCGAGATTATACTAGAATCAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-3244s21c1
Sequence:CCGGGTGTATTCTAGATCATCTAAGCTCGAGCTTAGATGATCTAGAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-624s21c1
Sequence:CCGGTACATAGCTGATCGTTTAAATCTCGAGATTTAAACGATCAGCTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000319294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-1023s21c1
Sequence:CCGGCGTGAGTATTTGGAAAGAGAACTCGAGTTCTCTTTCCAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012255
VALIDATED
XRN2 MISSION shRNA shRNA Plasmid DNA
5'-3' exoribonuclease 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000049898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012255.2-810s1c1
Sequence:CCGGCCACACATGAACCGAACTTTACTCGAGTAAAGTTCGGTTCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-2218s1c1
Sequence:CCGGCCCTGAACTATGTCATGGGATCTCGAGATCCCATGACATAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-1598s1c1
Sequence:CCGGCCAGAGGATAATGTCAGGTTACTCGAGTAACCTGACATTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012255.2-1541s1c1
Sequence:CCGGCCGTCTCCATTAGGAGGAATTCTCGAGAATTCCTCCTAATGGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-1013s1c1
Sequence:CCGGCGTGAGTATTTGGAAAGAGAACTCGAGTTCTCTTTCCAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-820s21c1
Sequence:CCGGCCACACATGAACCGAACTTTACTCGAGTAAAGTTCGGTTCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-1952s21c1
Sequence:CCGGTGATCCTGATTCTAGTATAATCTCGAGATTATACTAGAATCAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-3244s21c1
Sequence:CCGGGTGTATTCTAGATCATCTAAGCTCGAGCTTAGATGATCTAGAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-624s21c1
Sequence:CCGGTACATAGCTGATCGTTTAAATCTCGAGATTTAAACGATCAGCTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000319294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-1023s21c1
Sequence:CCGGCGTGAGTATTTGGAAAGAGAACTCGAGTTCTCTTTCCAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012255
VALIDATED
XRN2 MISSION shRNA Lentiviral Transduction Particles
5'-3' exoribonuclease 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000049898    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012255.2-810s1c1
Sequence:CCGGCCACACATGAACCGAACTTTACTCGAGTAAAGTTCGGTTCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049899    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-2218s1c1
Sequence:CCGGCCCTGAACTATGTCATGGGATCTCGAGATCCCATGACATAGTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-1598s1c1
Sequence:CCGGCCAGAGGATAATGTCAGGTTACTCGAGTAACCTGACATTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012255.2-1541s1c1
Sequence:CCGGCCGTCTCCATTAGGAGGAATTCTCGAGAATTCCTCCTAATGGAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049900    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_012255.2-1013s1c1
Sequence:CCGGCGTGAGTATTTGGAAAGAGAACTCGAGTTCTCTTTCCAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349677    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-820s21c1
Sequence:CCGGCCACACATGAACCGAACTTTACTCGAGTAAAGTTCGGTTCATGTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-1952s21c1
Sequence:CCGGTGATCCTGATTCTAGTATAATCTCGAGATTATACTAGAATCAGGATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293640    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-3244s21c1
Sequence:CCGGGTGTATTCTAGATCATCTAAGCTCGAGCTTAGATGATCTAGAATACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-624s21c1
Sequence:CCGGTACATAGCTGATCGTTTAAATCTCGAGATTTAAACGATCAGCTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000319294    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_012255.3-1023s21c1
Sequence:CCGGCGTGAGTATTTGGAAAGAGAACTCGAGTTCTCTTTCCAAATACTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011917
VALIDATED
XRN2 MISSION shRNA Bacterial Glycerol Stock
5'-3' exoribonuclease 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1513s1c1
Sequence:CCGGCCAGAGGATAACGTCAGGTTACTCGAGTAACCTGACGTTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-127s1c1
Sequence:CCGGCCAAATGATGTGGAGTTTGATCTCGAGATCAAACTCCACATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1552s1c1
Sequence:CCGGCAACGATACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-524s1c1
Sequence:CCGGGCTATTACATAGCTGATCGTTCTCGAGAACGATCAGCTATGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1693s1c1
Sequence:CCGGCCATTCCATTATGCACCATTTCTCGAGAAATGGTGCATAATGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-795s21c1
Sequence:CCGGGAACCTAACTTCACCATAATCCTCGAGGATTATGGTGAAGTTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011917.2-3091s21c1
Sequence:CCGGGAGATGTGTATGGCATAATACCTCGAGGTATTATGCCATACACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-189s21c1
Sequence:CCGGCCAAATGATGTGGAGTTTGATCTCGAGATCAAACTCCACATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-591s21c1
Sequence:CCGGTACATAGCTGATCGTTTAAATCTCGAGATTTAAACGATCAGCTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-1614s21c1
Sequence:CCGGCAACGATACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011917
VALIDATED
XRN2 MISSION shRNA shRNA Plasmid DNA
5'-3' exoribonuclease 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1513s1c1
Sequence:CCGGCCAGAGGATAACGTCAGGTTACTCGAGTAACCTGACGTTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-127s1c1
Sequence:CCGGCCAAATGATGTGGAGTTTGATCTCGAGATCAAACTCCACATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1552s1c1
Sequence:CCGGCAACGATACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-524s1c1
Sequence:CCGGGCTATTACATAGCTGATCGTTCTCGAGAACGATCAGCTATGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1693s1c1
Sequence:CCGGCCATTCCATTATGCACCATTTCTCGAGAAATGGTGCATAATGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-795s21c1
Sequence:CCGGGAACCTAACTTCACCATAATCCTCGAGGATTATGGTGAAGTTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011917.2-3091s21c1
Sequence:CCGGGAGATGTGTATGGCATAATACCTCGAGGTATTATGCCATACACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-189s21c1
Sequence:CCGGCCAAATGATGTGGAGTTTGATCTCGAGATCAAACTCCACATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-591s21c1
Sequence:CCGGTACATAGCTGATCGTTTAAATCTCGAGATTTAAACGATCAGCTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-1614s21c1
Sequence:CCGGCAACGATACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011917
VALIDATED
XRN2 MISSION shRNA Lentiviral Transduction Particles
5'-3' exoribonuclease 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119957    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1513s1c1
Sequence:CCGGCCAGAGGATAACGTCAGGTTACTCGAGTAACCTGACGTTATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-127s1c1
Sequence:CCGGCCAAATGATGTGGAGTTTGATCTCGAGATCAAACTCCACATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119960    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1552s1c1
Sequence:CCGGCAACGATACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119961    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-524s1c1
Sequence:CCGGGCTATTACATAGCTGATCGTTCTCGAGAACGATCAGCTATGTAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119958    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011917.1-1693s1c1
Sequence:CCGGCCATTCCATTATGCACCATTTCTCGAGAAATGGTGCATAATGGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-795s21c1
Sequence:CCGGGAACCTAACTTCACCATAATCCTCGAGGATTATGGTGAAGTTAGGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011917.2-3091s21c1
Sequence:CCGGGAGATGTGTATGGCATAATACCTCGAGGTATTATGCCATACACATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339918    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-189s21c1
Sequence:CCGGCCAAATGATGTGGAGTTTGATCTCGAGATCAAACTCCACATCATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-591s21c1
Sequence:CCGGTACATAGCTGATCGTTTAAATCTCGAGATTTAAACGATCAGCTATGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011917.2-1614s21c1
Sequence:CCGGCAACGATACTACAAGAACAAACTCGAGTTTGTTCTTGTAGTATCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks