EMAIL THIS PAGE TO A FRIEND

XRRA1

X-ray radiation resistance associated 1

UniProtKB ID: Q6P2D8, B5MD90, J3KNJ1, Q7RTT7, Q7Z463, Q7Z4U0
Gene ID:
Mouse(446101) X-ray radiation resistance associated 1
Rat(365313) X-ray radiation resistance associated 1
Zebrafish(100536325) X-ray radiation resistance associated 1
dog(476805) X-ray radiation resistance associated 1
Horse(100064954) X-ray radiation resistance associated 1
domestic cat(101093044) X-ray radiation resistance associated 1
naked mole-rat(101706708) X-ray radiation resistance associated 1
Domestic Rabbit(100355342) X-ray radiation resistance associated 1
domestic guinea pig(100734032) X-ray radiation resistance associated 1
cow(369019) X-ray radiation resistance associated 1
sheep(101107131) X-ray radiation resistance associated 1
233 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001164258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001164258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001164258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_182969 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182969 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182969 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU079211 MISSION® esiRNA esiRNA human XRRA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182969 Rosetta Predictions human pricing
XM_374912 Rosetta Predictions human pricing
XM_930468 Rosetta Predictions human pricing
XM_934939 Rosetta Predictions human pricing
XM_934941 Rosetta Predictions human pricing
XM_934946 Rosetta Predictions human pricing
XM_934948 Rosetta Predictions human pricing
XM_934949 Rosetta Predictions human pricing
XM_934950 Rosetta Predictions human pricing
NM_001113753 Rosetta Predictions rat pricing
XM_344923 Rosetta Predictions rat pricing
XM_194369 Rosetta Predictions mouse pricing
XM_905323 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182969 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371114 predicted 678
2 SASI_Hs02_00371115 predicted 2306
3 SASI_Hs02_00371116 predicted 1147
4 SASI_Hs02_00371117 predicted 1245
5 SASI_Hs02_00371118 predicted 1092
6 SASI_Hs02_00371119 predicted 2328
7 SASI_Hs02_00371120 predicted 2317
8 SASI_Hs02_00371121 predicted 633
9 SASI_Hs02_00371122 predicted 797
10 SASI_Hs02_00371123 predicted 1671
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_374912 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00256051 predicted 394
2 SASI_Hs01_00256052 predicted 468
3 SASI_Hs01_00256053 predicted 2099
4 SASI_Hs01_00256054 predicted 944
5 SASI_Hs01_00256055 predicted 1042
6 SASI_Hs01_00256056 predicted 888
7 SASI_Hs01_00256057 predicted 879
8 SASI_Hs01_00256058 predicted 2109
9 SASI_Hs01_00256059 predicted 579
10 SASI_Hs01_00256060 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930468 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00257398 predicted 1082
2 SASI_Hs01_00257399 predicted 1026
3 SASI_Hs01_00257400 predicted 1018
4 SASI_Hs01_00257401 predicted 1986
5 SASI_Hs01_00257402 predicted 565
6 SASI_Hs01_00257403 predicted 476
7 SASI_Hs01_00257404 predicted 736
8 SASI_Hs01_00257405 predicted 846
9 SASI_Hs01_00257406 predicted 2096
10 SASI_Hs01_00257407 predicted 895
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00260988 predicted 1768
2 SASI_Hs01_00260989 predicted 1753
3 SASI_Hs01_00260990 predicted 1796
4 SASI_Hs01_00260991 predicted 1340
5 SASI_Hs01_00260992 predicted 1357
6 SASI_Hs01_00260993 predicted 1761
7 SASI_Hs01_00260994 predicted 1182
8 SASI_Hs01_00260995 predicted 1939
9 SASI_Hs01_00260996 predicted 1492
10 SASI_Hs01_00260997 predicted 1647
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00293033 predicted 1441
2 SASI_Hs01_00293034 predicted 1528
3 SASI_Hs01_00293035 predicted 1524
4 SASI_Hs01_00293036 predicted 1495
5 SASI_Hs01_00293037 predicted 1355
6 SASI_Hs01_00293038 predicted 1488
7 SASI_Hs01_00293039 predicted 1546
8 SASI_Hs01_00293040 predicted 1491
9 SASI_Hs01_00293041 predicted 1483
10 SASI_Hs01_00293042 predicted 1281
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934946 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264287 predicted 1641
2 SASI_Hs01_00264288 predicted 1085
3 SASI_Hs01_00264289 predicted 1393
4 SASI_Hs01_00264290 predicted 1651
5 SASI_Hs01_00264291 predicted 1642
6 SASI_Hs01_00264292 predicted 996
7 SASI_Hs01_00264293 predicted 1161
8 SASI_Hs01_00264294 predicted 1873
9 SASI_Hs01_00264295 predicted 2021
10 SASI_Hs01_00264296 predicted 1494
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934948 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00252117 predicted 353
2 SASI_Hs01_00252118 predicted 1718
3 SASI_Hs01_00252119 predicted 829
4 SASI_Hs01_00252120 predicted 925
5 SASI_Hs01_00252121 predicted 771
6 SASI_Hs01_00252122 predicted 763
7 SASI_Hs01_00252123 predicted 1732
8 SASI_Hs01_00252124 predicted 1734
9 SASI_Hs01_00252125 predicted 310
10 SASI_Hs01_00252126 predicted 471
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934949 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00296284 predicted 1022
2 SASI_Hs01_00296285 predicted 461
3 SASI_Hs01_00296286 predicted 781
4 SASI_Hs01_00296287 predicted 1697
5 SASI_Hs01_00296288 predicted 1034
6 SASI_Hs01_00296289 predicted 1021
7 SASI_Hs01_00296290 predicted 545
8 SASI_Hs01_00296291 predicted 1246
9 SASI_Hs01_00296292 predicted 1400
10 SASI_Hs01_00296293 predicted 872
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_934950 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00255581 predicted 958
2 SASI_Hs01_00255582 predicted 394
3 SASI_Hs01_00255583 predicted 709
4 SASI_Hs01_00255584 predicted 966
5 SASI_Hs01_00255585 predicted 965
6 SASI_Hs01_00255586 predicted 310
7 SASI_Hs01_00255587 predicted 474
8 SASI_Hs01_00255588 predicted 1188
9 SASI_Hs01_00255589 predicted 1339
10 SASI_Hs01_00255590 predicted 805
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001113753 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00251993 predicted 556
2 SASI_Rn02_00251994 predicted 685
3 SASI_Rn02_00251995 predicted 487
4 SASI_Rn02_00251996 predicted 501
5 SASI_Rn02_00251997 predicted 653
6 SASI_Rn02_00251998 predicted 600
7 SASI_Rn02_00251999 predicted 433
8 SASI_Rn02_00252000 predicted 372
9 SASI_Rn02_00252001 predicted 324
10 SASI_Rn02_00252002 predicted 632
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344923 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00126430 predicted 401
2 SASI_Rn01_00126431 predicted 402
3 SASI_Rn01_00126432 predicted 395
4 SASI_Rn01_00126433 predicted 433
5 SASI_Rn01_00126434 predicted 397
6 SASI_Rn01_00126435 predicted 387
7 SASI_Rn01_00126436 predicted 424
8 SASI_Rn01_00126437 predicted 918
9 SASI_Rn01_00126438 predicted 1028
10 SASI_Rn01_00126439 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_194369 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00425468 predicted 1311
2 SASI_Mm02_00425469 predicted 796
3 SASI_Mm01_00253144 predicted 488
4 SASI_Mm02_00425470 predicted 674
5 SASI_Mm01_00253146 predicted 471
6 SASI_Mm02_00425471 predicted 649
7 SASI_Mm02_00425472 predicted 1780
8 SASI_Mm02_00425473 predicted 1987
9 SASI_Mm02_00425474 predicted 1808
10 SASI_Mm02_00425475 predicted 309
11 SASI_Mm01_00253141 predicted 1832
12 SASI_Mm01_00253142 predicted 2314
13 SASI_Mm01_00253143 predicted 1975
14 SASI_Mm01_00253145 predicted 1971
15 SASI_Mm01_00253147 predicted 234
16 SASI_Mm01_00253148 predicted 552
17 SASI_Mm01_00253149 predicted 2009
18 SASI_Mm01_00253150 predicted 297
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_905323 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00431677 predicted 1321
2 SASI_Mm02_00431678 predicted 807
3 SASI_Mm02_00431679 predicted 2311
4 SASI_Mm02_00431680 predicted 495
5 SASI_Mm02_00431681 predicted 678
6 SASI_Mm02_00431682 predicted 480
7 SASI_Mm02_00431683 predicted 648
8 SASI_Mm02_00431684 predicted 1624
9 SASI_Mm02_00431685 predicted 1083
10 SASI_Mm02_00431686 predicted 1784
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001164258
XRRA1 MISSION shRNA Bacterial Glycerol Stock
X-ray radiation resistance associated 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-489s21c1
Sequence:CCGGTGCTACCTCTAGATGTCTTTCCTCGAGGAAAGACATCTAGAGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-2119s21c1
Sequence:CCGGAGCGCAGCTGCTGGATGATATCTCGAGATATCATCCAGCAGCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-555s21c1
Sequence:CCGGTCAAGATGGTCTACGTGAAATCTCGAGATTTCACGTAGACCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-894s21c1
Sequence:CCGGTTGTCCGGATCCCGTACTTACCTCGAGGTAAGTACGGGATCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-318s21c1
Sequence:CCGGCAGACGTTCTTGGACACATTTCTCGAGAAATGTGTCCAAGAACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001164258
XRRA1 MISSION shRNA shRNA Plasmid DNA
X-ray radiation resistance associated 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-489s21c1
Sequence:CCGGTGCTACCTCTAGATGTCTTTCCTCGAGGAAAGACATCTAGAGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-2119s21c1
Sequence:CCGGAGCGCAGCTGCTGGATGATATCTCGAGATATCATCCAGCAGCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-555s21c1
Sequence:CCGGTCAAGATGGTCTACGTGAAATCTCGAGATTTCACGTAGACCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-894s21c1
Sequence:CCGGTTGTCCGGATCCCGTACTTACCTCGAGGTAAGTACGGGATCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-318s21c1
Sequence:CCGGCAGACGTTCTTGGACACATTTCTCGAGAAATGTGTCCAAGAACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001164258
XRRA1 MISSION shRNA Lentiviral Transduction Particles
X-ray radiation resistance associated 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367325    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-489s21c1
Sequence:CCGGTGCTACCTCTAGATGTCTTTCCTCGAGGAAAGACATCTAGAGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367326    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-2119s21c1
Sequence:CCGGAGCGCAGCTGCTGGATGATATCTCGAGATATCATCCAGCAGCTGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-555s21c1
Sequence:CCGGTCAAGATGGTCTACGTGAAATCTCGAGATTTCACGTAGACCATCTTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-894s21c1
Sequence:CCGGTTGTCCGGATCCCGTACTTACCTCGAGGTAAGTACGGGATCCGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367328    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001164258.1-318s21c1
Sequence:CCGGCAGACGTTCTTGGACACATTTCTCGAGAAATGTGTCCAAGAACGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182969
XRRA1 MISSION shRNA Bacterial Glycerol Stock
X-ray radiation resistance associated 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-639s21c1
Sequence:CCGGTCAGATCTGTGCACCATTAATCTCGAGATTAATGGTGCACAGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-1255s21c1
Sequence:CCGGCAGATGAGCAACTGGATTATACTCGAGTATAATCCAGTTGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-1607s21c1
Sequence:CCGGGCGACTGGGAATCCACTTAATCTCGAGATTAAGTGGATTCCCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-761s21c1
Sequence:CCGGGGAACTGGATCTCGCATTTAACTCGAGTTAAATGCGAGATCCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182969.1-3470s21c1
Sequence:CCGGAGACAAGACTCTGACTATAAACTCGAGTTTATAGTCAGAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182969
XRRA1 MISSION shRNA shRNA Plasmid DNA
X-ray radiation resistance associated 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-639s21c1
Sequence:CCGGTCAGATCTGTGCACCATTAATCTCGAGATTAATGGTGCACAGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-1255s21c1
Sequence:CCGGCAGATGAGCAACTGGATTATACTCGAGTATAATCCAGTTGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-1607s21c1
Sequence:CCGGGCGACTGGGAATCCACTTAATCTCGAGATTAAGTGGATTCCCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-761s21c1
Sequence:CCGGGGAACTGGATCTCGCATTTAACTCGAGTTAAATGCGAGATCCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182969.1-3470s21c1
Sequence:CCGGAGACAAGACTCTGACTATAAACTCGAGTTTATAGTCAGAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182969
XRRA1 MISSION shRNA Lentiviral Transduction Particles
X-ray radiation resistance associated 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-639s21c1
Sequence:CCGGTCAGATCTGTGCACCATTAATCTCGAGATTAATGGTGCACAGATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246334    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-1255s21c1
Sequence:CCGGCAGATGAGCAACTGGATTATACTCGAGTATAATCCAGTTGCTCATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-1607s21c1
Sequence:CCGGGCGACTGGGAATCCACTTAATCTCGAGATTAAGTGGATTCCCAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246333    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182969.1-761s21c1
Sequence:CCGGGGAACTGGATCTCGCATTTAACTCGAGTTAAATGCGAGATCCAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257505    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_182969.1-3470s21c1
Sequence:CCGGAGACAAGACTCTGACTATAAACTCGAGTTTATAGTCAGAGTCTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks