EMAIL THIS PAGE TO A FRIEND

XXYLT1

xyloside xylosyltransferase 1

Synonyms: C3orf21
UniProtKB ID: Q8NBI6, D3DNW5, Q8NAL3, Q8WV03, Q96ME0
Gene ID:
Mouse(268880) xyloside xylosyltransferase 1
Rat(363799) xyloside xylosyltransferase 1
chicken(424896) xyloside xylosyltransferase 1
dog(609818) xyloside xylosyltransferase 1
domestic cat(101089207) xyloside xylosyltransferase 1
cow(533703) xyloside xylosyltransferase 1
sheep(101105043) xyloside xylosyltransferase 1
domestic guinea pig(100735128) xyloside xylosyltransferase 1
naked mole-rat(101724924) xyloside xylosyltransferase 1
44 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302148 ANTI-CC021 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_152531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152531 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198626 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198626 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198626 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152531 Rosetta Predictions human pricing
XM_344027 Rosetta Predictions rat pricing
NM_198626 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229609 predicted 880
2 SASI_Hs01_00229610 predicted 736
3 SASI_Hs01_00229611 predicted 775
4 SASI_Hs01_00229612 predicted 879
5 SASI_Hs02_00366333 predicted 703
6 SASI_Hs01_00229614 predicted 598
7 SASI_Hs01_00229615 predicted 902
8 SASI_Hs01_00229616 predicted 770
9 SASI_Hs01_00229617 predicted 880
10 SASI_Hs01_00229618 predicted 620
11 SASI_Hs01_00229613 predicted 1209
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396714 predicted 854
2 SASI_Rn02_00396715 predicted 1635
3 SASI_Rn02_00396716 predicted 627
4 SASI_Rn02_00396717 predicted 1567
5 SASI_Rn02_00396718 predicted 913
6 SASI_Rn02_00396719 predicted 707
7 SASI_Rn02_00396720 predicted 626
8 SASI_Rn02_00396721 predicted 1620
9 SASI_Rn02_00396722 predicted 1680
10 SASI_Rn02_00396723 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198626 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132600 predicted 531
2 SASI_Mm01_00132601 predicted 555
3 SASI_Mm01_00132602 predicted 334
4 SASI_Mm02_00351075 predicted 1464
5 SASI_Mm01_00132603 predicted 802
6 SASI_Mm01_00132604 predicted 707
7 SASI_Mm01_00132605 predicted 1173
8 SASI_Mm01_00132606 predicted 895
9 SASI_Mm01_00132607 predicted 1503
10 SASI_Mm01_00132608 predicted 815
11 SASI_Mm01_00132609 predicted 1500
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152531
VALIDATED
XXYLT1 MISSION shRNA Bacterial Glycerol Stock
xyloside xylosyltransferase 1
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-390s1c1
Sequence:CCGGCCTGCTGATGATGTTCACCAACTCGAGTTGGTGAACATCATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-774s1c1
Sequence:CCGGCCTGAAGTTTAAGACCAACATCTCGAGATGTTGGTCTTAAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-582s1c1
Sequence:CCGGCTTCAAGTGCAAGGTCATCTTCTCGAGAAGATGACCTTGCACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-811s1c1
Sequence:CCGGGAATTTGACAGTTTCCTGCCACTCGAGTGGCAGGAAACTGTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-675s1c1
Sequence:CCGGCTTGGGAACCTACTACAGTGACTCGAGTCACTGTAGTAGGTTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-864s1c1
Sequence:CCGGGCCAGTTTACAGGCACACATTCTCGAGAATGTGTGCCTGTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-1374s1c1
Sequence:CCGGGCAGGGAAGTCCTGTGATTAACTCGAGTTAATCACAGGACTTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-1080s1c1
Sequence:CCGGCCAGGACTTCTTCACCATGATCTCGAGATCATGGTGAAGAAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152531.3-2422s1c1
Sequence:CCGGGCAATTCCCAAGTGTGACCATCTCGAGATGGTCACACTTGGGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-680s1c1
Sequence:CCGGGAACCTACTACAGTGACTCCACTCGAGTGGAGTCACTGTAGTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-1931s1c1
Sequence:CCGGGCTTGTATCTCCCAGCTACATCTCGAGATGTAGCTGGGAGATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-492s1c1
Sequence:CCGGCGAGGTGCTTAACCTTCACTTCTCGAGAAGTGAAGGTTAAGCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152531
VALIDATED
XXYLT1 MISSION shRNA shRNA Plasmid DNA
xyloside xylosyltransferase 1
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-390s1c1
Sequence:CCGGCCTGCTGATGATGTTCACCAACTCGAGTTGGTGAACATCATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-774s1c1
Sequence:CCGGCCTGAAGTTTAAGACCAACATCTCGAGATGTTGGTCTTAAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-582s1c1
Sequence:CCGGCTTCAAGTGCAAGGTCATCTTCTCGAGAAGATGACCTTGCACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-811s1c1
Sequence:CCGGGAATTTGACAGTTTCCTGCCACTCGAGTGGCAGGAAACTGTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-675s1c1
Sequence:CCGGCTTGGGAACCTACTACAGTGACTCGAGTCACTGTAGTAGGTTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-864s1c1
Sequence:CCGGGCCAGTTTACAGGCACACATTCTCGAGAATGTGTGCCTGTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-1374s1c1
Sequence:CCGGGCAGGGAAGTCCTGTGATTAACTCGAGTTAATCACAGGACTTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-1080s1c1
Sequence:CCGGCCAGGACTTCTTCACCATGATCTCGAGATCATGGTGAAGAAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152531.3-2422s1c1
Sequence:CCGGGCAATTCCCAAGTGTGACCATCTCGAGATGGTCACACTTGGGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-680s1c1
Sequence:CCGGGAACCTACTACAGTGACTCCACTCGAGTGGAGTCACTGTAGTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-1931s1c1
Sequence:CCGGGCTTGTATCTCCCAGCTACATCTCGAGATGTAGCTGGGAGATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-492s1c1
Sequence:CCGGCGAGGTGCTTAACCTTCACTTCTCGAGAAGTGAAGGTTAAGCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152531
VALIDATED
XXYLT1 MISSION shRNA Lentiviral Transduction Particles
xyloside xylosyltransferase 1
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156328    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-390s1c1
Sequence:CCGGCCTGCTGATGATGTTCACCAACTCGAGTTGGTGAACATCATCAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-774s1c1
Sequence:CCGGCCTGAAGTTTAAGACCAACATCTCGAGATGTTGGTCTTAAACTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-582s1c1
Sequence:CCGGCTTCAAGTGCAAGGTCATCTTCTCGAGAAGATGACCTTGCACTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153291    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-811s1c1
Sequence:CCGGGAATTTGACAGTTTCCTGCCACTCGAGTGGCAGGAAACTGTCAAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-675s1c1
Sequence:CCGGCTTGGGAACCTACTACAGTGACTCGAGTCACTGTAGTAGGTTCCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156626    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-864s1c1
Sequence:CCGGGCCAGTTTACAGGCACACATTCTCGAGAATGTGTGCCTGTAAACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-1374s1c1
Sequence:CCGGGCAGGGAAGTCCTGTGATTAACTCGAGTTAATCACAGGACTTCCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158040    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-1080s1c1
Sequence:CCGGCCAGGACTTCTTCACCATGATCTCGAGATCATGGTGAAGAAGTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157398    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152531.3-2422s1c1
Sequence:CCGGGCAATTCCCAAGTGTGACCATCTCGAGATGGTCACACTTGGGAATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156813    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152531.3-680s1c1
Sequence:CCGGGAACCTACTACAGTGACTCCACTCGAGTGGAGTCACTGTAGTAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157202    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_152531.3-1931s1c1
Sequence:CCGGGCTTGTATCTCCCAGCTACATCTCGAGATGTAGCTGGGAGATACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158293    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_152531.3-492s1c1
Sequence:CCGGCGAGGTGCTTAACCTTCACTTCTCGAGAAGTGAAGGTTAAGCACCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198626
XXYLT1 MISSION shRNA Bacterial Glycerol Stock
xyloside xylosyltransferase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000094002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-1176s1c1
Sequence:CCGGCGTCAAGATCTACCATGGGAACTCGAGTTCCCATGGTAGATCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198626.1-1496s1c1
Sequence:CCGGCCCTTGTAAAGAACTGGCTTTCTCGAGAAAGCCAGTTCTTTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-726s1c1
Sequence:CCGGCCTGAAGTATAAGACCAACATCTCGAGATGTTGGTCTTATACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-993s1c1
Sequence:CCGGGCTTGCTGACAAGTACCACTTCTCGAGAAGTGGTACTTGTCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000094003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-342s1c1
Sequence:CCGGCCTGCTGATGATGTTCACCAACTCGAGTTGGTGAACATCATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198626
XXYLT1 MISSION shRNA shRNA Plasmid DNA
xyloside xylosyltransferase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000094002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-1176s1c1
Sequence:CCGGCGTCAAGATCTACCATGGGAACTCGAGTTCCCATGGTAGATCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198626.1-1496s1c1
Sequence:CCGGCCCTTGTAAAGAACTGGCTTTCTCGAGAAAGCCAGTTCTTTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-726s1c1
Sequence:CCGGCCTGAAGTATAAGACCAACATCTCGAGATGTTGGTCTTATACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-993s1c1
Sequence:CCGGGCTTGCTGACAAGTACCACTTCTCGAGAAGTGGTACTTGTCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000094003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-342s1c1
Sequence:CCGGCCTGCTGATGATGTTCACCAACTCGAGTTGGTGAACATCATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198626
XXYLT1 MISSION shRNA Lentiviral Transduction Particles
xyloside xylosyltransferase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000094002    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-1176s1c1
Sequence:CCGGCGTCAAGATCTACCATGGGAACTCGAGTTCCCATGGTAGATCTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198626.1-1496s1c1
Sequence:CCGGCCCTTGTAAAGAACTGGCTTTCTCGAGAAAGCCAGTTCTTTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-726s1c1
Sequence:CCGGCCTGAAGTATAAGACCAACATCTCGAGATGTTGGTCTTATACTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094000    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-993s1c1
Sequence:CCGGGCTTGCTGACAAGTACCACTTCTCGAGAAGTGGTACTTGTCAGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000094003    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198626.1-342s1c1
Sequence:CCGGCCTGCTGATGATGTTCACCAACTCGAGTTGGTGAACATCATCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks