EMAIL THIS PAGE TO A FRIEND

XYLB

xylulokinase homolog (H. influenzae)

UniProtKB ID: O75191, B2RAW4, B9EH64
Gene ID:
Human(9942) Summary: The protein encoded by this gene shares 22% sequence identity with Hemophilus influenzae xylulokinase, and even higher identity to other gene products in C.elegans (45%) and yeast (31-35%), which are thought to belong to a family of enzymes that include fucokinase, gluconokinase, glycerokinase and xylulokinase. These proteins play important roles in energy metabolism. [provided by RefSeq, Aug 2009]
Mouse(102448) xylulokinase homolog (H. influenzae)
Rat(316067) xylulokinase homolog (H. influenzae)
Zebrafish(393350) xylulokinase homolog (H. influenzae)
chicken(420432) xylulokinase homolog (H. influenzae)
domestic cat(101086341) xylulokinase homolog (H. influenzae)
Horse(100049952) xylulokinase homolog (H. influenzae)
dog(609126) xylulokinase homolog (H. influenzae)
cow(515146) xylulokinase homolog (H. influenzae)
sheep(101116261) xylulokinase homolog (H. influenzae)
naked mole-rat(101712072) xylulokinase homolog (H. influenzae)
domestic guinea pig(100733661) xylulokinase homolog (H. influenzae)
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005108 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_135223 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_135223 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_135223 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001033209 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033209 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033209 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005108 Rosetta Predictions human pricing
NM_001033704 Rosetta Predictions rat pricing
NM_001033209 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101615 predicted 271
2 SASI_Hs01_00101616 predicted 1584
3 SASI_Hs01_00101617 predicted 325
4 SASI_Hs01_00101618 predicted 922
5 SASI_Hs01_00101619 predicted 1265
6 SASI_Hs01_00101621 predicted 299
7 SASI_Hs01_00101622 predicted 891
8 SASI_Hs01_00101623 predicted 1145
9 SASI_Hs02_00338995 predicted 1270
10 SASI_Hs02_00338996 predicted 990
11 SASI_Hs01_00101620 predicted 774
12 SASI_Hs01_00101624 predicted 768
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033704 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00203743 predicted 818
2 SASI_Rn01_00066731 predicted 1155
3 SASI_Rn01_00066732 predicted 249
4 SASI_Rn01_00066733 predicted 404
5 SASI_Rn01_00066734 predicted 1289
6 SASI_Rn01_00066736 predicted 784
7 SASI_Rn01_00066737 predicted 1557
8 SASI_Rn01_00066738 predicted 261
9 SASI_Rn02_00203744 predicted 1029
10 SASI_Rn01_00066739 predicted 1333
11 SASI_Rn01_00066730 predicted 923
12 SASI_Rn01_00066735 predicted 996
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033209 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144244 predicted 1081
2 SASI_Mm01_00144245 predicted 917
3 SASI_Mm01_00144246 predicted 1043
4 SASI_Mm01_00144247 predicted 1419
5 SASI_Mm01_00144248 predicted 1650
6 SASI_Mm01_00144249 predicted 1141
7 SASI_Mm01_00144250 predicted 513
8 SASI_Mm01_00144251 predicted 1415
9 SASI_Mm01_00144252 predicted 1500
10 SASI_Mm01_00144253 predicted 668
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005108
VALIDATED
XYLB MISSION shRNA Bacterial Glycerol Stock
xylulokinase homolog (H. influenzae)
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005108.2-269s1c1
Sequence:CCGGGCGGTGTTCATGTGCACAAGGCTCGAGCCTTGTGCACATGAACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1285s1c1
Sequence:CCGGCGTCATAGGTTTAACACAGAACTCGAGTTCTGTGTTAAACCTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1495s1c1
Sequence:CCGGCCGGTGTATGTTATAGACACTCTCGAGAGTGTCTATAACATACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005108.2-2390s1c1
Sequence:CCGGCCAAACTCACTTGGCATAATTCTCGAGAATTATGCCAAGTGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1336s1c1
Sequence:CCGGGTGGAGGTTCGAGCACTAATTCTCGAGAATTAGTGCTCGAACCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-2573s1c1
Sequence:CCGGGCTGAAGAAGTTGTGTCATTTCTCGAGAAATGACACAACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1345s1c1
Sequence:CCGGCGAGCACTAATTGAAGGACAACTCGAGTTGTCCTTCAATTAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1594s1c1
Sequence:CCGGGTTGTGAAGTTAGCTCCAAATCTCGAGATTTGGAGCTAACTTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-407s1c1
Sequence:CCGGGCCAGCAACACGGAAGTATATCTCGAGATATACTTCCGTGTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-199s1c1
Sequence:CCGGGCAGAGTTGAATGTCTTCTATCTCGAGATAGAAGACATTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1270s1c1
Sequence:CCGGCCTGAAATTATTGGACGTCATCTCGAGATGACGTCCAATAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-865s21c1
Sequence:CCGGCTCAGTTGTGGGAGCCATTTCCTCGAGGAAATGGCTCCCACAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-436s21c1
Sequence:CCGGGCAGGCACTGACAAGCTTATCCTCGAGGATAAGCTTGTCAGTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-893s21c1
Sequence:CCGGTACGTCCAGCGCTACGGATTTCTCGAGAAATCCGTAGCGCTGGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-666s21c1
Sequence:CCGGCCTACTCACATACGGAGAGAACTCGAGTTCTCTCCGTATGTGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005108.3-1985s21c1
Sequence:CCGGGAGACTGGGATATGTCCAATACTCGAGTATTGGACATATCCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005108
VALIDATED
XYLB MISSION shRNA shRNA Plasmid DNA
xylulokinase homolog (H. influenzae)
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005108.2-269s1c1
Sequence:CCGGGCGGTGTTCATGTGCACAAGGCTCGAGCCTTGTGCACATGAACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1285s1c1
Sequence:CCGGCGTCATAGGTTTAACACAGAACTCGAGTTCTGTGTTAAACCTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1495s1c1
Sequence:CCGGCCGGTGTATGTTATAGACACTCTCGAGAGTGTCTATAACATACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005108.2-2390s1c1
Sequence:CCGGCCAAACTCACTTGGCATAATTCTCGAGAATTATGCCAAGTGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1336s1c1
Sequence:CCGGGTGGAGGTTCGAGCACTAATTCTCGAGAATTAGTGCTCGAACCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-2573s1c1
Sequence:CCGGGCTGAAGAAGTTGTGTCATTTCTCGAGAAATGACACAACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1345s1c1
Sequence:CCGGCGAGCACTAATTGAAGGACAACTCGAGTTGTCCTTCAATTAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1594s1c1
Sequence:CCGGGTTGTGAAGTTAGCTCCAAATCTCGAGATTTGGAGCTAACTTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-407s1c1
Sequence:CCGGGCCAGCAACACGGAAGTATATCTCGAGATATACTTCCGTGTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-199s1c1
Sequence:CCGGGCAGAGTTGAATGTCTTCTATCTCGAGATAGAAGACATTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1270s1c1
Sequence:CCGGCCTGAAATTATTGGACGTCATCTCGAGATGACGTCCAATAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-865s21c1
Sequence:CCGGCTCAGTTGTGGGAGCCATTTCCTCGAGGAAATGGCTCCCACAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-436s21c1
Sequence:CCGGGCAGGCACTGACAAGCTTATCCTCGAGGATAAGCTTGTCAGTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-893s21c1
Sequence:CCGGTACGTCCAGCGCTACGGATTTCTCGAGAAATCCGTAGCGCTGGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-666s21c1
Sequence:CCGGCCTACTCACATACGGAGAGAACTCGAGTTCTCTCCGTATGTGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005108.3-1985s21c1
Sequence:CCGGGAGACTGGGATATGTCCAATACTCGAGTATTGGACATATCCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005108
VALIDATED
XYLB MISSION shRNA Lentiviral Transduction Particles
xylulokinase homolog (H. influenzae)
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199568    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005108.2-269s1c1
Sequence:CCGGGCGGTGTTCATGTGCACAAGGCTCGAGCCTTGTGCACATGAACACCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1285s1c1
Sequence:CCGGCGTCATAGGTTTAACACAGAACTCGAGTTCTGTGTTAAACCTATGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194852    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1495s1c1
Sequence:CCGGCCGGTGTATGTTATAGACACTCTCGAGAGTGTCTATAACATACACCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194942    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_005108.2-2390s1c1
Sequence:CCGGCCAAACTCACTTGGCATAATTCTCGAGAATTATGCCAAGTGAGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1336s1c1
Sequence:CCGGGTGGAGGTTCGAGCACTAATTCTCGAGAATTAGTGCTCGAACCTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196269    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.57 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-2573s1c1
Sequence:CCGGGCTGAAGAAGTTGTGTCATTTCTCGAGAAATGACACAACTTCTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037929    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1345s1c1
Sequence:CCGGCGAGCACTAATTGAAGGACAACTCGAGTTGTCCTTCAATTAGTGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-1594s1c1
Sequence:CCGGGTTGTGAAGTTAGCTCCAAATCTCGAGATTTGGAGCTAACTTCACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-407s1c1
Sequence:CCGGGCCAGCAACACGGAAGTATATCTCGAGATATACTTCCGTGTTGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037930    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005108.2-199s1c1
Sequence:CCGGGCAGAGTTGAATGTCTTCTATCTCGAGATAGAAGACATTCAACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037931    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005108.2-1270s1c1
Sequence:CCGGCCTGAAATTATTGGACGTCATCTCGAGATGACGTCCAATAATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-865s21c1
Sequence:CCGGCTCAGTTGTGGGAGCCATTTCCTCGAGGAAATGGCTCCCACAACTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-436s21c1
Sequence:CCGGGCAGGCACTGACAAGCTTATCCTCGAGGATAAGCTTGTCAGTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-893s21c1
Sequence:CCGGTACGTCCAGCGCTACGGATTTCTCGAGAAATCCGTAGCGCTGGACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005108.3-666s21c1
Sequence:CCGGCCTACTCACATACGGAGAGAACTCGAGTTCTCTCCGTATGTGAGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427458    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005108.3-1985s21c1
Sequence:CCGGGAGACTGGGATATGTCCAATACTCGAGTATTGGACATATCCCAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_135223
XYLB MISSION shRNA Bacterial Glycerol Stock
xylulokinase homolog (H. influenzae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000024709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-349s1c1
Sequence:CCGGGCAGAGTTGAACGTCTTCTATCTCGAGATAGAAGACGTTCAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-1252s1c1
Sequence:CCGGCAGCATTACATGGCGCTTCTACTCGAGTAGAAGCGCCATGTAATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-921s1c1
Sequence:CCGGCGGAATGAATCTGTTGCAGATCTCGAGATCTGCAACAGATTCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-1435s1c1
Sequence:CCGGCGTCATAGGTTTAATGCGGAACTCGAGTTCCGCATTAAACCTATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_135223
XYLB MISSION shRNA shRNA Plasmid DNA
xylulokinase homolog (H. influenzae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000024709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-349s1c1
Sequence:CCGGGCAGAGTTGAACGTCTTCTATCTCGAGATAGAAGACGTTCAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-1252s1c1
Sequence:CCGGCAGCATTACATGGCGCTTCTACTCGAGTAGAAGCGCCATGTAATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-921s1c1
Sequence:CCGGCGGAATGAATCTGTTGCAGATCTCGAGATCTGCAACAGATTCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-1435s1c1
Sequence:CCGGCGTCATAGGTTTAATGCGGAACTCGAGTTCCGCATTAAACCTATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_135223
XYLB MISSION shRNA Lentiviral Transduction Particles
xylulokinase homolog (H. influenzae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000024709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-349s1c1
Sequence:CCGGGCAGAGTTGAACGTCTTCTATCTCGAGATAGAAGACGTTCAACTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-1252s1c1
Sequence:CCGGCAGCATTACATGGCGCTTCTACTCGAGTAGAAGCGCCATGTAATGCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024712    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-921s1c1
Sequence:CCGGCGGAATGAATCTGTTGCAGATCTCGAGATCTGCAACAGATTCATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_135223.2-1435s1c1
Sequence:CCGGCGTCATAGGTTTAATGCGGAACTCGAGTTCCGCATTAAACCTATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033209
XYLB MISSION shRNA Bacterial Glycerol Stock
xylulokinase homolog (H. influenzae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000360767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033209.2-2329s21c1
Sequence:CCGGTTCATCTTCCCTCCCTATATGCTCGAGCATATAGGGAGGGAAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033209.2-2231s21c1
Sequence:CCGGCATCCTTAAACCAGACTAAAGCTCGAGCTTTAGTCTGGTTTAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-314s21c1
Sequence:CCGGTCAGCACGCAGCAGGTTAAAGCTCGAGCTTTAACCTGCTGCGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-366s21c1
Sequence:CCGGCTATGAGGACAGCGTGCATTTCTCGAGAAATGCACGCTGTCCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-1428s21c1
Sequence:CCGGTATTGGGCGTCATAGGTTTAACTCGAGTTAAACCTATGACGCCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033209
XYLB MISSION shRNA shRNA Plasmid DNA
xylulokinase homolog (H. influenzae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000360767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033209.2-2329s21c1
Sequence:CCGGTTCATCTTCCCTCCCTATATGCTCGAGCATATAGGGAGGGAAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033209.2-2231s21c1
Sequence:CCGGCATCCTTAAACCAGACTAAAGCTCGAGCTTTAGTCTGGTTTAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-314s21c1
Sequence:CCGGTCAGCACGCAGCAGGTTAAAGCTCGAGCTTTAACCTGCTGCGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-366s21c1
Sequence:CCGGCTATGAGGACAGCGTGCATTTCTCGAGAAATGCACGCTGTCCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-1428s21c1
Sequence:CCGGTATTGGGCGTCATAGGTTTAACTCGAGTTAAACCTATGACGCCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033209
XYLB MISSION shRNA Lentiviral Transduction Particles
xylulokinase homolog (H. influenzae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000360767    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033209.2-2329s21c1
Sequence:CCGGTTCATCTTCCCTCCCTATATGCTCGAGCATATAGGGAGGGAAGATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360765    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033209.2-2231s21c1
Sequence:CCGGCATCCTTAAACCAGACTAAAGCTCGAGCTTTAGTCTGGTTTAAGGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-314s21c1
Sequence:CCGGTCAGCACGCAGCAGGTTAAAGCTCGAGCTTTAACCTGCTGCGTGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-366s21c1
Sequence:CCGGCTATGAGGACAGCGTGCATTTCTCGAGAAATGCACGCTGTCCTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368760    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033209.2-1428s21c1
Sequence:CCGGTATTGGGCGTCATAGGTTTAACTCGAGTTAAACCTATGACGCCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks