EMAIL THIS PAGE TO A FRIEND

XYLT1

xylosyltransferase I

Synonyms: PXYLT1 XT-I XT1 XTI XYLTI
UniProtKB ID: Q86Y38, Q9H1B6
Gene ID:
Human(64131) Summary: This locus encodes a xylosyltransferase enzyme. The encoded protein catalyzes transfer of UDP-xylose to serine residues of an acceptor protein substrate. This transfer reaction is necessary for biosynthesis of glycosaminoglycan chains. Mutations in this gene have been associated with increased severity of pseudoxanthoma elasticum.[provided by RefSeq, Nov 2009]
Mouse(233781) xylosyltransferase 1
Rat(64133) xylosyltransferase 1
Zebrafish(560951) xylosyltransferase I
chicken(414781) xylosyltransferase I
Horse(100053250) xylosyltransferase I
dog(494008) xylosyltransferase I
naked mole-rat(101726675) xylosyltransferase I
cow(541295) xylosyltransferase I
188 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022166 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022166 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022166 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175645 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175645 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175645 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU037151 MISSION® esiRNA esiRNA human XYLT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022166 Rosetta Predictions human pricing
XM_001078643 Rosetta Predictions rat pricing
XM_341912 Rosetta Predictions rat pricing
NM_175645 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022166 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237415 predicted 1858
2 SASI_Hs01_00237416 predicted 957
3 SASI_Hs01_00237417 predicted 1389
4 SASI_Hs01_00237418 predicted 2477
5 SASI_Hs01_00237421 predicted 1171
6 SASI_Hs01_00237422 predicted 2094
7 SASI_Hs01_00237423 predicted 2198
8 SASI_Hs01_00237424 predicted 1063
9 SASI_Hs02_00355597 predicted 692
10 SASI_Hs02_00355598 predicted 1118
11 SASI_Hs01_00237419 predicted 2285
12 SASI_Hs01_00237420 predicted 1412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361568 predicted 1039
2 SASI_Rn02_00361569 predicted 1063
3 SASI_Rn02_00361570 predicted 2625
4 SASI_Rn02_00361571 predicted 2182
5 SASI_Rn02_00361572 predicted 1463
6 SASI_Rn02_00361573 predicted 2233
7 SASI_Rn02_00361574 predicted 828
8 SASI_Rn02_00361575 predicted 1030
9 SASI_Rn02_00361576 predicted 1876
10 SASI_Rn02_00361577 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341912 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00142129 predicted 589
2 SASI_Rn01_00142130 predicted 1722
3 SASI_Rn01_00142131 predicted 1899
4 SASI_Rn01_00142132 predicted 1960
5 SASI_Rn01_00142133 predicted 546
6 SASI_Rn01_00142134 predicted 752
7 SASI_Rn01_00142135 predicted 1605
8 SASI_Rn01_00142136 predicted 1430
9 SASI_Rn01_00142137 predicted 2089
10 SASI_Rn01_00142138 predicted 1594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175645 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00045264 predicted 1227
2 SASI_Mm01_00045266 predicted 1656
3 SASI_Mm01_00045267 predicted 2502
4 SASI_Mm01_00045268 predicted 2640
5 SASI_Mm01_00045270 predicted 1487
6 SASI_Mm01_00045269 predicted 2555
7 SASI_Mm01_00045271 predicted 2566
8 SASI_Mm02_00346575 predicted 1017
9 SASI_Mm01_00045272 predicted 1220
10 SASI_Mm02_00346576 predicted 2239
11 SASI_Mm01_00045265 predicted 1257
12 SASI_Mm01_00045273 predicted 1271
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022166
XYLT1 MISSION shRNA Bacterial Glycerol Stock
xylosyltransferase I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022166.3-3337s21c1
Sequence:CCGGGGTTCAGGGTGCTGACGAAATCTCGAGATTTCGTCAGCACCCTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000439268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1380s21c1
Sequence:CCGGATGACCAGTTGGTGGCGTTTCCTCGAGGAAACGCCACCAACTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1160s21c1
Sequence:CCGGCACGTGGACAAGCGCTCTAATCTCGAGATTAGAGCGCTTGTCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1579s21c1
Sequence:CCGGGAACCGGAGGTTTGTAGAATACTCGAGTATTCTACAAACCTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1442s1c1
Sequence:CCGGCGGGACAATGCAAGGTTCATTCTCGAGAATGAACCTTGCATTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1891s1c1
Sequence:CCGGCGTGGTGAATCAGGAAATCATCTCGAGATGATTTCCTGATTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-2333s1c1
Sequence:CCGGGAGAGGCTATTCCGCAACTTTCTCGAGAAAGTTGCGGAATAGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1411s1c1
Sequence:CCGGCCGAGATATGAATTTCTTGAACTCGAGTTCAAGAAATTCATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-994s1c1
Sequence:CCGGCGAGGGTAAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022166
XYLT1 MISSION shRNA shRNA Plasmid DNA
xylosyltransferase I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022166.3-3337s21c1
Sequence:CCGGGGTTCAGGGTGCTGACGAAATCTCGAGATTTCGTCAGCACCCTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000439268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1380s21c1
Sequence:CCGGATGACCAGTTGGTGGCGTTTCCTCGAGGAAACGCCACCAACTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1160s21c1
Sequence:CCGGCACGTGGACAAGCGCTCTAATCTCGAGATTAGAGCGCTTGTCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1579s21c1
Sequence:CCGGGAACCGGAGGTTTGTAGAATACTCGAGTATTCTACAAACCTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1442s1c1
Sequence:CCGGCGGGACAATGCAAGGTTCATTCTCGAGAATGAACCTTGCATTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1891s1c1
Sequence:CCGGCGTGGTGAATCAGGAAATCATCTCGAGATGATTTCCTGATTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-2333s1c1
Sequence:CCGGGAGAGGCTATTCCGCAACTTTCTCGAGAAAGTTGCGGAATAGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1411s1c1
Sequence:CCGGCCGAGATATGAATTTCTTGAACTCGAGTTCAAGAAATTCATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-994s1c1
Sequence:CCGGCGAGGGTAAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022166
XYLT1 MISSION shRNA Lentiviral Transduction Particles
xylosyltransferase I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447305    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022166.3-3337s21c1
Sequence:CCGGGGTTCAGGGTGCTGACGAAATCTCGAGATTTCGTCAGCACCCTGAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000439268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1380s21c1
Sequence:CCGGATGACCAGTTGGTGGCGTTTCCTCGAGGAAACGCCACCAACTGGTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437027    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1160s21c1
Sequence:CCGGCACGTGGACAAGCGCTCTAATCTCGAGATTAGAGCGCTTGTCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022166.3-1579s21c1
Sequence:CCGGGAACCGGAGGTTTGTAGAATACTCGAGTATTCTACAAACCTCCGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1442s1c1
Sequence:CCGGCGGGACAATGCAAGGTTCATTCTCGAGAATGAACCTTGCATTGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1891s1c1
Sequence:CCGGCGTGGTGAATCAGGAAATCATCTCGAGATGATTTCCTGATTCACCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-2333s1c1
Sequence:CCGGGAGAGGCTATTCCGCAACTTTCTCGAGAAAGTTGCGGAATAGCCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034883    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-1411s1c1
Sequence:CCGGCCGAGATATGAATTTCTTGAACTCGAGTTCAAGAAATTCATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022166.1-994s1c1
Sequence:CCGGCGAGGGTAAAGCCAACAAGAACTCGAGTTCTTGTTGGCTTTACCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175645
XYLT1 MISSION shRNA Bacterial Glycerol Stock
xylosyltransferase I
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000427398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175645.3-1227s21c1
Sequence:CCGGATCTACCACAAAGACCATTTCCTCGAGGAAATGGTCTTTGTGGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175645.3-284s21c1
Sequence:CCGGGACGCTGGTGGTGTGGAATTTCTCGAGAAATTCCACACCACCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-2561s1c1
Sequence:CCGGGCCACCTATGATATCCTGATTCTCGAGAATCAGGATATCATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1588s1c1
Sequence:CCGGCCTGGAGTGTGATACACACATCTCGAGATGTGTGTATCACACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-2717s1c1
Sequence:CCGGTCCAACAAGCAGCCCATCAAACTCGAGTTTGATGGGCTGCTTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1027s1c1
Sequence:CCGGAGAAACCTACTGTCGCCACAACTCGAGTTGTGGCGACAGTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1106s1c1
Sequence:CCGGCACAAGAATGTCCAGTGGGATCTCGAGATCCCACTGGACATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175645
XYLT1 MISSION shRNA shRNA Plasmid DNA
xylosyltransferase I
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000427398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175645.3-1227s21c1
Sequence:CCGGATCTACCACAAAGACCATTTCCTCGAGGAAATGGTCTTTGTGGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175645.3-284s21c1
Sequence:CCGGGACGCTGGTGGTGTGGAATTTCTCGAGAAATTCCACACCACCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-2561s1c1
Sequence:CCGGGCCACCTATGATATCCTGATTCTCGAGAATCAGGATATCATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1588s1c1
Sequence:CCGGCCTGGAGTGTGATACACACATCTCGAGATGTGTGTATCACACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-2717s1c1
Sequence:CCGGTCCAACAAGCAGCCCATCAAACTCGAGTTTGATGGGCTGCTTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1027s1c1
Sequence:CCGGAGAAACCTACTGTCGCCACAACTCGAGTTGTGGCGACAGTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1106s1c1
Sequence:CCGGCACAAGAATGTCCAGTGGGATCTCGAGATCCCACTGGACATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175645
XYLT1 MISSION shRNA Lentiviral Transduction Particles
xylosyltransferase I
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000427398    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175645.3-1227s21c1
Sequence:CCGGATCTACCACAAAGACCATTTCCTCGAGGAAATGGTCTTTGTGGTAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175645.3-284s21c1
Sequence:CCGGGACGCTGGTGGTGTGGAATTTCTCGAGAAATTCCACACCACCAGCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093684    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-2561s1c1
Sequence:CCGGGCCACCTATGATATCCTGATTCTCGAGAATCAGGATATCATAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093686    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1588s1c1
Sequence:CCGGCCTGGAGTGTGATACACACATCTCGAGATGTGTGTATCACACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093688    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-2717s1c1
Sequence:CCGGTCCAACAAGCAGCCCATCAAACTCGAGTTTGATGGGCTGCTTGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1027s1c1
Sequence:CCGGAGAAACCTACTGTCGCCACAACTCGAGTTGTGGCGACAGTAGGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093685    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175645.2-1106s1c1
Sequence:CCGGCACAAGAATGTCCAGTGGGATCTCGAGATCCCACTGGACATTCTTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks