EMAIL THIS PAGE TO A FRIEND

XYLT2

xylosyltransferase II

Synonyms: PXYLT2 XT-II XT2 xylT-II
UniProtKB ID: Q9H1B5, Q6UY41, Q86V00
Gene ID:
Human(64132) Summary: The protein encoded by this gene is an isoform of xylosyltransferase, which belongs to a family of glycosyltransferases. This enzyme transfers xylose from UDP-xylose to specific serine residues of the core protein and initiates the biosynthesis of glycosaminoglycan chains in proteoglycans including chondroitin sulfate, heparan sulfate, heparin and dermatan sulfate. The enzyme activity, which is increased in scleroderma patients, is a diagnostic marker for the determination of sclerotic activity in systemic sclerosis. [provided by RefSeq, Jul 2008]
Mouse(217119) xylosyltransferase II
Rat(64134) xylosyltransferase II
cow(493989) xylosyltransferase II
sheep(101107112) xylosyltransferase II
naked mole-rat(101703898) xylosyltransferase II
domestic guinea pig(100714934) xylosyltransferase II
chicken(414780) xylosyltransferase II
domestic cat(101099511) xylosyltransferase II
dog(493990) xylosyltransferase II
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2102730 Anti-XYLT2 antibody produced in rabbit affinity isolated antibody bovine, guinea pig, rabbit, human, canine, mouse, rat, horse
western blot pricing
SAB2104844 Anti-XYLT2 antibody produced in rabbit affinity isolated antibody rat, guinea pig, horse, canine, mouse, human, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145828 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145828 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145828 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022167 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022167 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022167 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022167 Rosetta Predictions human pricing
NM_022296 Rosetta Predictions rat pricing
NM_145828 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022167 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355599 predicted 2430
2 SASI_Hs01_00054992 predicted 2201
3 SASI_Hs01_00054993 predicted 2361
4 SASI_Hs01_00054994 predicted 2734
5 SASI_Hs02_00355600 predicted 2201
6 SASI_Hs01_00054995 predicted 1186
7 SASI_Hs01_00054996 predicted 526
8 SASI_Hs01_00054997 predicted 1151
9 SASI_Hs01_00054999 predicted 1281
10 SASI_Hs01_00055000 predicted 947
11 SASI_Hs01_00054998 predicted 1156
12 SASI_Hs01_00055001 predicted 2363
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022296 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00101083 predicted 1269
2 SASI_Rn01_00101084 predicted 1077
3 SASI_Rn01_00101086 predicted 915
4 SASI_Rn01_00101087 predicted 927
5 SASI_Rn01_00101088 predicted 2233
6 SASI_Rn01_00101089 predicted 1371
7 SASI_Rn01_00101090 predicted 2331
8 SASI_Rn01_00101091 predicted 462
9 SASI_Rn01_00101092 predicted 1222
10 SASI_Rn02_00263112 predicted 1048
11 SASI_Rn01_00101085 predicted 1786
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145828 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201020 predicted 1356
2 SASI_Mm01_00201021 predicted 1303
3 SASI_Mm01_00201022 predicted 1012
4 SASI_Mm01_00201023 predicted 2737
5 SASI_Mm01_00201024 predicted 1941
6 SASI_Mm02_00341295 predicted 542
7 SASI_Mm01_00201025 predicted 1860
8 SASI_Mm01_00201026 predicted 1107
9 SASI_Mm01_00201027 predicted 1118
10 SASI_Mm01_00201028 predicted 1129
11 SASI_Mm01_00201029 predicted 1740
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145828
XYLT2 MISSION shRNA Bacterial Glycerol Stock
xylosyltransferase II
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000093892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-877s1c1
Sequence:CCGGCCAGTTCTATACATACACATTCTCGAGAATGTGTATGTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-1918s1c1
Sequence:CCGGCGAATACATGGAGCAGAGTTTCTCGAGAAACTCTGCTCCATGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145828.1-2428s1c1
Sequence:CCGGGCTCCTCGTTAGTTTATACTTCTCGAGAAGTATAAACTAACGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-876s1c1
Sequence:CCGGGCCAGTTCTATACATACACATCTCGAGATGTGTATGTATAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000093891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-679s1c1
Sequence:CCGGGCGAGACAATTCCAGGTTCATCTCGAGATGAACCTGGAATTGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145828
XYLT2 MISSION shRNA shRNA Plasmid DNA
xylosyltransferase II
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000093892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-877s1c1
Sequence:CCGGCCAGTTCTATACATACACATTCTCGAGAATGTGTATGTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-1918s1c1
Sequence:CCGGCGAATACATGGAGCAGAGTTTCTCGAGAAACTCTGCTCCATGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145828.1-2428s1c1
Sequence:CCGGGCTCCTCGTTAGTTTATACTTCTCGAGAAGTATAAACTAACGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-876s1c1
Sequence:CCGGGCCAGTTCTATACATACACATCTCGAGATGTGTATGTATAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000093891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-679s1c1
Sequence:CCGGGCGAGACAATTCCAGGTTCATCTCGAGATGAACCTGGAATTGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145828
XYLT2 MISSION shRNA Lentiviral Transduction Particles
xylosyltransferase II
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000093892    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-877s1c1
Sequence:CCGGCCAGTTCTATACATACACATTCTCGAGAATGTGTATGTATAGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093893    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-1918s1c1
Sequence:CCGGCGAATACATGGAGCAGAGTTTCTCGAGAAACTCTGCTCCATGTATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093889    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145828.1-2428s1c1
Sequence:CCGGGCTCCTCGTTAGTTTATACTTCTCGAGAAGTATAAACTAACGAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093890    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-876s1c1
Sequence:CCGGGCCAGTTCTATACATACACATCTCGAGATGTGTATGTATAGAACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000093891    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145828.1-679s1c1
Sequence:CCGGGCGAGACAATTCCAGGTTCATCTCGAGATGAACCTGGAATTGTCTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022167
VALIDATED
XYLT2 MISSION shRNA Bacterial Glycerol Stock
xylosyltransferase II
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022167.1-2422s1c1
Sequence:CCGGCGAGTACATGGAGCAGAGTTTCTCGAGAAACTCTGCTCCATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-2201s1c1
Sequence:CCGGGCCACATCTTATGACATCACACTCGAGTGTGATGTCATAAGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-857s1c1
Sequence:CCGGCGTCTCCTCAAGGCCGTTTATCTCGAGATAAACGGCCTTGAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-1183s1c1
Sequence:CCGGCCGGGACAACTCCAGGTTCATCTCGAGATGAACCTGGAGTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022167.1-1889s1c1
Sequence:CCGGCTGTATTTCTATGACGACCATCTCGAGATGGTCGTCATAGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000444742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-521s21c1
Sequence:CCGGTTCCCACCACACGGAGATACACTCGAGTGTATCTCCGTGTGGTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-2230s21c1
Sequence:CCGGGGAGACTGAGGTCACGCAATACTCGAGTATTGCGTGACCTCAGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-1089s21c1
Sequence:CCGGACCTCAGTGCCACTGACTATCCTCGAGGATAGTCAGTGGCACTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-2349s21c1
Sequence:CCGGCCTTGACCTTCAACCGCAAACCTCGAGGTTTGCGGTTGAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022167.2-2734s21c1
Sequence:CCGGGACCCGGGAAATTGCACCTTACTCGAGTAAGGTGCAATTTCCCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022167
VALIDATED
XYLT2 MISSION shRNA shRNA Plasmid DNA
xylosyltransferase II
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022167.1-2422s1c1
Sequence:CCGGCGAGTACATGGAGCAGAGTTTCTCGAGAAACTCTGCTCCATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-2201s1c1
Sequence:CCGGGCCACATCTTATGACATCACACTCGAGTGTGATGTCATAAGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-857s1c1
Sequence:CCGGCGTCTCCTCAAGGCCGTTTATCTCGAGATAAACGGCCTTGAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-1183s1c1
Sequence:CCGGCCGGGACAACTCCAGGTTCATCTCGAGATGAACCTGGAGTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022167.1-1889s1c1
Sequence:CCGGCTGTATTTCTATGACGACCATCTCGAGATGGTCGTCATAGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000444742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-521s21c1
Sequence:CCGGTTCCCACCACACGGAGATACACTCGAGTGTATCTCCGTGTGGTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-2230s21c1
Sequence:CCGGGGAGACTGAGGTCACGCAATACTCGAGTATTGCGTGACCTCAGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-1089s21c1
Sequence:CCGGACCTCAGTGCCACTGACTATCCTCGAGGATAGTCAGTGGCACTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-2349s21c1
Sequence:CCGGCCTTGACCTTCAACCGCAAACCTCGAGGTTTGCGGTTGAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022167.2-2734s21c1
Sequence:CCGGGACCCGGGAAATTGCACCTTACTCGAGTAAGGTGCAATTTCCCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022167
VALIDATED
XYLT2 MISSION shRNA Lentiviral Transduction Particles
xylosyltransferase II
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034914    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_022167.1-2422s1c1
Sequence:CCGGCGAGTACATGGAGCAGAGTTTCTCGAGAAACTCTGCTCCATGTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034918    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-2201s1c1
Sequence:CCGGGCCACATCTTATGACATCACACTCGAGTGTGATGTCATAAGATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-857s1c1
Sequence:CCGGCGTCTCCTCAAGGCCGTTTATCTCGAGATAAACGGCCTTGAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034915    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022167.1-1183s1c1
Sequence:CCGGCCGGGACAACTCCAGGTTCATCTCGAGATGAACCTGGAGTTGTCCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034916    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: A549
TRC Version: 1 Clone ID:NM_022167.1-1889s1c1
Sequence:CCGGCTGTATTTCTATGACGACCATCTCGAGATGGTCGTCATAGAAATACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000444742    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-521s21c1
Sequence:CCGGTTCCCACCACACGGAGATACACTCGAGTGTATCTCCGTGTGGTGGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443329    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-2230s21c1
Sequence:CCGGGGAGACTGAGGTCACGCAATACTCGAGTATTGCGTGACCTCAGTCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-1089s21c1
Sequence:CCGGACCTCAGTGCCACTGACTATCCTCGAGGATAGTCAGTGGCACTGAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022167.2-2349s21c1
Sequence:CCGGCCTTGACCTTCAACCGCAAACCTCGAGGTTTGCGGTTGAAGGTCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438179    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_022167.2-2734s21c1
Sequence:CCGGGACCCGGGAAATTGCACCTTACTCGAGTAAGGTGCAATTTCCCGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks