EMAIL THIS PAGE TO A FRIEND

YAE1D1

Yae1 domain containing 1

Synonyms: C7orf36
UniProtKB ID: Q9NRH1, A4D1W4, Q6IAF7, Q8WVZ5
Gene ID:
Mouse(67008) Yae1 domain containing 1
Rat(306994) Yae1 domain containing 1
domestic cat(101091268) Yae1 domain containing 1
dog(609096) Yae1 domain containing 1
cow(508613) Yae1 domain containing 1
sheep(101122019) Yae1 domain containing 1
domestic guinea pig(100718029) Yae1 domain containing 1
naked mole-rat(101707058) Yae1 domain containing 1
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025904 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025904 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025904 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020192 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020192 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020192 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020192 Rosetta Predictions human pricing
NM_001107356 Rosetta Predictions rat pricing
NM_025904 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020192 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090853 predicted 387
2 SASI_Hs01_00090854 predicted 241
3 SASI_Hs01_00090855 predicted 372
4 SASI_Hs02_00353112 predicted 273
5 SASI_Hs01_00090858 predicted 281
6 SASI_Hs01_00090859 predicted 520
7 SASI_Hs01_00090860 predicted 419
8 SASI_Hs01_00090861 predicted 413
9 SASI_Hs01_00090862 predicted 270
10 SASI_Hs02_00353113 predicted 314
11 SASI_Hs01_00090856 predicted 466
12 SASI_Hs01_00090857 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107356 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00228015 predicted 688
2 SASI_Rn02_00228016 predicted 622
3 SASI_Rn02_00228017 predicted 464
4 SASI_Rn02_00228018 predicted 478
5 SASI_Rn02_00228019 predicted 689
6 SASI_Rn02_00228020 predicted 295
7 SASI_Rn02_00228021 predicted 630
8 SASI_Rn02_00228022 predicted 517
9 SASI_Rn02_00228023 predicted 397
10 SASI_Rn02_00228024 predicted 295
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025904 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066001 predicted 840
2 SASI_Mm01_00066002 predicted 613
3 SASI_Mm01_00065997 predicted 416
4 SASI_Mm01_00066003 predicted 703
5 SASI_Mm01_00065998 predicted 786
6 SASI_Mm01_00066005 predicted 411
7 SASI_Mm01_00065999 predicted 781
8 SASI_Mm01_00066000 predicted 795
9 SASI_Mm02_00329259 predicted 349
10 SASI_Mm01_00066006 predicted 700
11 SASI_Mm01_00066004 predicted 838
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025904
VALIDATED
YAE1D1 MISSION shRNA Bacterial Glycerol Stock
Yae1 domain containing 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000285982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-509s21c1
Sequence:CCGGACCGATTCTGACAGTCCAAATCTCGAGATTTGGACTGTCAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-408s21c1
Sequence:CCGGAGCCACGAGTTACGGATTTATCTCGAGATAAATCCGTAACTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025904.2-294s1c1
Sequence:CCGGGGTGTCACCTTCATGGTAATACTCGAGTATTACCATGAAGGTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-613s21c1
Sequence:CCGGGCAGACATCCAGTTTAGTGAACTCGAGTTCACTAAACTGGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-1035s21c1
Sequence:CCGGTAACCTGAAAGCTAGCATAAACTCGAGTTTATGCTAGCTTTCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-236s21c1
Sequence:CCGGGCAGACGTCATTATAAACTATCTCGAGATAGTTTATAATGACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025904.1-614s1c1
Sequence:CCGGGCAGACATCCAGTTTAGTGAACTCGAGTTCACTAAACTGGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1659s1c1
Sequence:CCGGCGCACAGAACATTAAGAGATTCTCGAGAATCTCTTAATGTTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1490s1c1
Sequence:CCGGCCACCTGAAGTTAATATACAACTCGAGTTGTATATTAACTTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025904.1-237s1c1
Sequence:CCGGGCAGACGTCATTATAAACTATCTCGAGATAGTTTATAATGACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1571s1c1
Sequence:CCGGCCAGTATTTAGCTGTGCTGAACTCGAGTTCAGCACAGCTAAATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025904.1-538s1c1
Sequence:CCGGGTTGTTCACATCCAGAACATTCTCGAGAATGTTCTGGATGTGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025904
VALIDATED
YAE1D1 MISSION shRNA shRNA Plasmid DNA
Yae1 domain containing 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000285982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-509s21c1
Sequence:CCGGACCGATTCTGACAGTCCAAATCTCGAGATTTGGACTGTCAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-408s21c1
Sequence:CCGGAGCCACGAGTTACGGATTTATCTCGAGATAAATCCGTAACTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025904.2-294s1c1
Sequence:CCGGGGTGTCACCTTCATGGTAATACTCGAGTATTACCATGAAGGTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-613s21c1
Sequence:CCGGGCAGACATCCAGTTTAGTGAACTCGAGTTCACTAAACTGGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-1035s21c1
Sequence:CCGGTAACCTGAAAGCTAGCATAAACTCGAGTTTATGCTAGCTTTCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-236s21c1
Sequence:CCGGGCAGACGTCATTATAAACTATCTCGAGATAGTTTATAATGACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025904.1-614s1c1
Sequence:CCGGGCAGACATCCAGTTTAGTGAACTCGAGTTCACTAAACTGGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1659s1c1
Sequence:CCGGCGCACAGAACATTAAGAGATTCTCGAGAATCTCTTAATGTTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1490s1c1
Sequence:CCGGCCACCTGAAGTTAATATACAACTCGAGTTGTATATTAACTTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025904.1-237s1c1
Sequence:CCGGGCAGACGTCATTATAAACTATCTCGAGATAGTTTATAATGACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1571s1c1
Sequence:CCGGCCAGTATTTAGCTGTGCTGAACTCGAGTTCAGCACAGCTAAATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025904.1-538s1c1
Sequence:CCGGGTTGTTCACATCCAGAACATTCTCGAGAATGTTCTGGATGTGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025904
VALIDATED
YAE1D1 MISSION shRNA Lentiviral Transduction Particles
Yae1 domain containing 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000285982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-509s21c1
Sequence:CCGGACCGATTCTGACAGTCCAAATCTCGAGATTTGGACTGTCAGAATCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277570    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-408s21c1
Sequence:CCGGAGCCACGAGTTACGGATTTATCTCGAGATAAATCCGTAACTCGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217934    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025904.2-294s1c1
Sequence:CCGGGGTGTCACCTTCATGGTAATACTCGAGTATTACCATGAAGGTGACACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-613s21c1
Sequence:CCGGGCAGACATCCAGTTTAGTGAACTCGAGTTCACTAAACTGGATGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277572    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-1035s21c1
Sequence:CCGGTAACCTGAAAGCTAGCATAAACTCGAGTTTATGCTAGCTTTCAGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025904.2-236s21c1
Sequence:CCGGGCAGACGTCATTATAAACTATCTCGAGATAGTTTATAATGACGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025904.1-614s1c1
Sequence:CCGGGCAGACATCCAGTTTAGTGAACTCGAGTTCACTAAACTGGATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191412    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1659s1c1
Sequence:CCGGCGCACAGAACATTAAGAGATTCTCGAGAATCTCTTAATGTTCTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1490s1c1
Sequence:CCGGCCACCTGAAGTTAATATACAACTCGAGTTGTATATTAACTTCAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191484    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025904.1-237s1c1
Sequence:CCGGGCAGACGTCATTATAAACTATCTCGAGATAGTTTATAATGACGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025904.1-1571s1c1
Sequence:CCGGCCAGTATTTAGCTGTGCTGAACTCGAGTTCAGCACAGCTAAATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025904.1-538s1c1
Sequence:CCGGGTTGTTCACATCCAGAACATTCTCGAGAATGTTCTGGATGTGAACAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020192
VALIDATED
YAE1D1 MISSION shRNA Bacterial Glycerol Stock
Yae1 domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-646s1c1
Sequence:CCGGCTGGGCCTATCAGTAGATGTACTCGAGTACATCTACTGATAGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-272s1c1
Sequence:CCGGCCTGGTGTCACCTTCATAATACTCGAGTATTATGAAGGTGACACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-388s1c1
Sequence:CCGGCCGTCCCATGTTGTAGATTTACTCGAGTAAATCTACAACATGGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-130s1c1
Sequence:CCGGCGAGTCAAAGAAGGTTATAGACTCGAGTCTATAACCTTCTTTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-128s1c1
Sequence:CCGGGACGAGTCAAAGAAGGTTATACTCGAGTATAACCTTCTTTGACTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-472s1c1
Sequence:CCGGGCTAAAGATGAAAGACTCTGTCTCGAGACAGAGTCTTTCATCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-424s1c1
Sequence:CCGGGATATGGACCTTTGTCATGTACTCGAGTACATGACAAAGGTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020192.1-421s1c1
Sequence:CCGGGAGGATATGGACCTTTGTCATCTCGAGATGACAAAGGTCCATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020192.1-151s1c1
Sequence:CCGGGATGGAATAGATGCTGGCAAACTCGAGTTTGCCAGCATCTATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-163s1c1
Sequence:CCGGGCTGGCAAAGCAGTTACTCTTCTCGAGAAGAGTAACTGCTTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020192
VALIDATED
YAE1D1 MISSION shRNA shRNA Plasmid DNA
Yae1 domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-646s1c1
Sequence:CCGGCTGGGCCTATCAGTAGATGTACTCGAGTACATCTACTGATAGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-272s1c1
Sequence:CCGGCCTGGTGTCACCTTCATAATACTCGAGTATTATGAAGGTGACACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-388s1c1
Sequence:CCGGCCGTCCCATGTTGTAGATTTACTCGAGTAAATCTACAACATGGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-130s1c1
Sequence:CCGGCGAGTCAAAGAAGGTTATAGACTCGAGTCTATAACCTTCTTTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-128s1c1
Sequence:CCGGGACGAGTCAAAGAAGGTTATACTCGAGTATAACCTTCTTTGACTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-472s1c1
Sequence:CCGGGCTAAAGATGAAAGACTCTGTCTCGAGACAGAGTCTTTCATCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-424s1c1
Sequence:CCGGGATATGGACCTTTGTCATGTACTCGAGTACATGACAAAGGTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020192.1-421s1c1
Sequence:CCGGGAGGATATGGACCTTTGTCATCTCGAGATGACAAAGGTCCATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020192.1-151s1c1
Sequence:CCGGGATGGAATAGATGCTGGCAAACTCGAGTTTGCCAGCATCTATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-163s1c1
Sequence:CCGGGCTGGCAAAGCAGTTACTCTTCTCGAGAAGAGTAACTGCTTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020192
VALIDATED
YAE1D1 MISSION shRNA Lentiviral Transduction Particles
Yae1 domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-646s1c1
Sequence:CCGGCTGGGCCTATCAGTAGATGTACTCGAGTACATCTACTGATAGGCCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137340    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-272s1c1
Sequence:CCGGCCTGGTGTCACCTTCATAATACTCGAGTATTATGAAGGTGACACCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-388s1c1
Sequence:CCGGCCGTCCCATGTTGTAGATTTACTCGAGTAAATCTACAACATGGGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134119    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-130s1c1
Sequence:CCGGCGAGTCAAAGAAGGTTATAGACTCGAGTCTATAACCTTCTTTGACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-128s1c1
Sequence:CCGGGACGAGTCAAAGAAGGTTATACTCGAGTATAACCTTCTTTGACTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134351    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-472s1c1
Sequence:CCGGGCTAAAGATGAAAGACTCTGTCTCGAGACAGAGTCTTTCATCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134536    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_020192.1-424s1c1
Sequence:CCGGGATATGGACCTTTGTCATGTACTCGAGTACATGACAAAGGTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137193    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020192.1-421s1c1
Sequence:CCGGGAGGATATGGACCTTTGTCATCTCGAGATGACAAAGGTCCATATCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137387    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020192.1-151s1c1
Sequence:CCGGGATGGAATAGATGCTGGCAAACTCGAGTTTGCCAGCATCTATTCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137759    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_020192.1-163s1c1
Sequence:CCGGGCTGGCAAAGCAGTTACTCTTCTCGAGAAGAGTAACTGCTTTGCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks