EMAIL THIS PAGE TO A FRIEND

YAF2

YY1 associated factor 2

UniProtKB ID: Q8IY57, A8K5P0, B4DFU3, G3V465, Q99710
Gene ID:
Human(10138) Summary: The protein encoded by this gene interacts with YY1, a zinc finger protein involved in negative regulation of muscle-restricted genes. This gene product itself contains a single N-terminal C2-X10-C2 zinc finger, and in contrast to YY1, is up-regulated during myogenic differentiation. It also facilitates proteolytic cleavage of YY1 by the calcium- activated protease, m-calpain, suggesting a mechanism by which this protein antagonizes the negative effect of YY1. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2010]
Mouse(67057) YY1 associated factor 2
Rat(690262) YY1 associated factor 2
naked mole-rat(101721152) YY1 associated factor 2
domestic guinea pig(100730847) YY1 associated factor 2
cow(536696) YY1 associated factor 2
sheep(101110409) YY1 associated factor 2
Zebrafish(692296) YY1 associated factor 2
domestic cat(101099476) YY1 associated factor 2
dog(609790) YY1 associated factor 2
chicken(417790) YY1 associated factor 2
202 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024189 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024189 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024189 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005748 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005748 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005748 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001012424 Rosetta Predictions human pricing
NM_005748 Rosetta Predictions human pricing
NM_001134871 Rosetta Predictions rat pricing
NM_024189 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218902 predicted 764
2 SASI_Hs01_00218903 predicted 266
3 SASI_Hs01_00218904 predicted 171
4 SASI_Hs01_00218905 predicted 596
5 SASI_Hs01_00218906 predicted 597
6 SASI_Hs01_00218907 predicted 163
7 SASI_Hs01_00218908 predicted 819
8 SASI_Hs01_00218909 predicted 342
9 SASI_Hs01_00218910 predicted 260
10 SASI_Hs01_00218911 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005748 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233736 predicted 965
2 SASI_Hs02_00340205 predicted 578
3 SASI_Hs01_00233737 predicted 634
4 SASI_Hs01_00233739 predicted 829
5 SASI_Hs01_00233740 predicted 926
6 SASI_Hs02_00340206 predicted 970
7 SASI_Hs02_00340207 predicted 817
8 SASI_Hs01_00233742 predicted 777
9 SASI_Hs01_00233743 predicted 661
10 SASI_Hs01_00233744 predicted 696
11 SASI_Hs01_00233738 predicted 972
12 SASI_Hs01_00233741 predicted 691
13 SASI_Hs01_00233745 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134871 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00258884 predicted 357
2 SASI_Rn02_00258885 predicted 1018
3 SASI_Rn02_00258886 predicted 813
4 SASI_Rn02_00258887 predicted 1048
5 SASI_Rn02_00258888 predicted 936
6 SASI_Rn02_00258889 predicted 1108
7 SASI_Rn02_00258890 predicted 1102
8 SASI_Rn02_00258891 predicted 927
9 SASI_Rn02_00258892 predicted 745
10 SASI_Rn02_00258893 predicted 506
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024189 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327520 predicted 1179
2 SASI_Mm01_00119663 predicted 680
3 SASI_Mm01_00119664 predicted 1118
4 SASI_Mm01_00119665 predicted 987
5 SASI_Mm01_00119666 predicted 1064
6 SASI_Mm01_00119667 predicted 957
7 SASI_Mm01_00119668 predicted 834
8 SASI_Mm01_00119669 predicted 940
9 SASI_Mm01_00119670 predicted 802
10 SASI_Mm01_00119671 predicted 1113
11 SASI_Mm01_00119672 predicted 769
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024189
VALIDATED
YAF2 MISSION shRNA Bacterial Glycerol Stock
YY1 associated factor 2
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-923s1c1
Sequence:CCGGGCAGTGTTATTGGTAAGTCTACTCGAGTAGACTTACCAATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-359s1c1
Sequence:CCGGCCAGTCGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-360s1c1
Sequence:CCGGCAGTCGAAGAAAGAGAAGAAACTCGAGTTTCTTCTCTTTCTTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-254s1c1
Sequence:CCGGCAAGTGCATGATGTGCGATGTCTCGAGACATCGCACATCATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-501s1c1
Sequence:CCGGGTTGGAGATCTAACAGTCATTCTCGAGAATGACTGTTAGATCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024189.5-923s21c1
Sequence:CCGGGCAGTGTTATTGGTAAGTCTACTCGAGTAGACTTACCAATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-254s21c1
Sequence:CCGGCAAGTGCATGATGTGCGATGTCTCGAGACATCGCACATCATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-359s21c1
Sequence:CCGGCCAGTCGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-501s21c1
Sequence:CCGGGTTGGAGATCTAACAGTCATTCTCGAGAATGACTGTTAGATCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024189
VALIDATED
YAF2 MISSION shRNA shRNA Plasmid DNA
YY1 associated factor 2
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-923s1c1
Sequence:CCGGGCAGTGTTATTGGTAAGTCTACTCGAGTAGACTTACCAATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-359s1c1
Sequence:CCGGCCAGTCGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-360s1c1
Sequence:CCGGCAGTCGAAGAAAGAGAAGAAACTCGAGTTTCTTCTCTTTCTTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-254s1c1
Sequence:CCGGCAAGTGCATGATGTGCGATGTCTCGAGACATCGCACATCATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-501s1c1
Sequence:CCGGGTTGGAGATCTAACAGTCATTCTCGAGAATGACTGTTAGATCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024189.5-923s21c1
Sequence:CCGGGCAGTGTTATTGGTAAGTCTACTCGAGTAGACTTACCAATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-254s21c1
Sequence:CCGGCAAGTGCATGATGTGCGATGTCTCGAGACATCGCACATCATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-359s21c1
Sequence:CCGGCCAGTCGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-501s21c1
Sequence:CCGGGTTGGAGATCTAACAGTCATTCTCGAGAATGACTGTTAGATCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024189
VALIDATED
YAF2 MISSION shRNA Lentiviral Transduction Particles
YY1 associated factor 2
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095204    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-923s1c1
Sequence:CCGGGCAGTGTTATTGGTAAGTCTACTCGAGTAGACTTACCAATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095205    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-359s1c1
Sequence:CCGGCCAGTCGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095207    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-360s1c1
Sequence:CCGGCAGTCGAAGAAAGAGAAGAAACTCGAGTTTCTTCTCTTTCTTCGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-254s1c1
Sequence:CCGGCAAGTGCATGATGTGCGATGTCTCGAGACATCGCACATCATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_024189.4-501s1c1
Sequence:CCGGGTTGGAGATCTAACAGTCATTCTCGAGAATGACTGTTAGATCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332379    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024189.5-923s21c1
Sequence:CCGGGCAGTGTTATTGGTAAGTCTACTCGAGTAGACTTACCAATAACACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332306    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-254s21c1
Sequence:CCGGCAAGTGCATGATGTGCGATGTCTCGAGACATCGCACATCATGCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-359s21c1
Sequence:CCGGCCAGTCGAAGAAAGAGAAGAACTCGAGTTCTTCTCTTTCTTCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024189.5-501s21c1
Sequence:CCGGGTTGGAGATCTAACAGTCATTCTCGAGAATGACTGTTAGATCTCCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005748
VALIDATED
YAF2 MISSION shRNA Bacterial Glycerol Stock
YY1 associated factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005748.3-650s1c1
Sequence:CCGGCCATGCAAATACACAGATTATCTCGAGATAATCTGTGTATTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_005748.3-170s1c1
Sequence:CCGGCGAGGCCTTCAAGTGCATGATCTCGAGATCATGCACTTGAAGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005748.3-582s1c1
Sequence:CCGGGCCTCATCATTGAATGGAGAACTCGAGTTCTCCATTCAATGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005748.3-276s1c1
Sequence:CCGGCCTCCTACACAGTCAAAGAAACTCGAGTTTCTTTGACTGTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005748.3-437s1c1
Sequence:CCGGGACAGTCATTATTACAGACTTCTCGAGAAGTCTGTAATAATGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005748.3-931s21c1
Sequence:CCGGTATTGGCATGTAACGAATTTACTCGAGTAAATTCGTTACATGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-592s21c1
Sequence:CCGGTGAATGGAGAATCTCATTAAACTCGAGTTTAATGAGATTCTCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-253s21c1
Sequence:CCGGAGCAGGTTACTCAGCAGTTTGCTCGAGCAAACTGCTGAGTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-430s21c1
Sequence:CCGGGAGATCTGACAGTCATTATTACTCGAGTAATAATGACTGTCAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-396s21c1
Sequence:CCGGCGGAGTAGTGCTCAGCATTTGCTCGAGCAAATGCTGAGCACTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005748
VALIDATED
YAF2 MISSION shRNA shRNA Plasmid DNA
YY1 associated factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005748.3-650s1c1
Sequence:CCGGCCATGCAAATACACAGATTATCTCGAGATAATCTGTGTATTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_005748.3-170s1c1
Sequence:CCGGCGAGGCCTTCAAGTGCATGATCTCGAGATCATGCACTTGAAGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005748.3-582s1c1
Sequence:CCGGGCCTCATCATTGAATGGAGAACTCGAGTTCTCCATTCAATGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005748.3-276s1c1
Sequence:CCGGCCTCCTACACAGTCAAAGAAACTCGAGTTTCTTTGACTGTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005748.3-437s1c1
Sequence:CCGGGACAGTCATTATTACAGACTTCTCGAGAAGTCTGTAATAATGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005748.3-931s21c1
Sequence:CCGGTATTGGCATGTAACGAATTTACTCGAGTAAATTCGTTACATGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-592s21c1
Sequence:CCGGTGAATGGAGAATCTCATTAAACTCGAGTTTAATGAGATTCTCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-253s21c1
Sequence:CCGGAGCAGGTTACTCAGCAGTTTGCTCGAGCAAACTGCTGAGTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-430s21c1
Sequence:CCGGGAGATCTGACAGTCATTATTACTCGAGTAATAATGACTGTCAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-396s21c1
Sequence:CCGGCGGAGTAGTGCTCAGCATTTGCTCGAGCAAATGCTGAGCACTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005748
VALIDATED
YAF2 MISSION shRNA Lentiviral Transduction Particles
YY1 associated factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108025    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 1 Clone ID:NM_005748.3-650s1c1
Sequence:CCGGCCATGCAAATACACAGATTATCTCGAGATAATCTGTGTATTTGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108028    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_005748.3-170s1c1
Sequence:CCGGCGAGGCCTTCAAGTGCATGATCTCGAGATCATGCACTTGAAGGCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005748.3-582s1c1
Sequence:CCGGGCCTCATCATTGAATGGAGAACTCGAGTTCTCCATTCAATGATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108026    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005748.3-276s1c1
Sequence:CCGGCCTCCTACACAGTCAAAGAAACTCGAGTTTCTTTGACTGTGTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108027    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A3
TRC Version: 1 Clone ID:NM_005748.3-437s1c1
Sequence:CCGGGACAGTCATTATTACAGACTTCTCGAGAAGTCTGTAATAATGACTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244842    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005748.3-931s21c1
Sequence:CCGGTATTGGCATGTAACGAATTTACTCGAGTAAATTCGTTACATGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244841    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-592s21c1
Sequence:CCGGTGAATGGAGAATCTCATTAAACTCGAGTTTAATGAGATTCTCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257298    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-253s21c1
Sequence:CCGGAGCAGGTTACTCAGCAGTTTGCTCGAGCAAACTGCTGAGTAACCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244840    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-430s21c1
Sequence:CCGGGAGATCTGACAGTCATTATTACTCGAGTAATAATGACTGTCAGATCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244839    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005748.3-396s21c1
Sequence:CCGGCGGAGTAGTGCTCAGCATTTGCTCGAGCAAATGCTGAGCACTACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks