EMAIL THIS PAGE TO A FRIEND

YAP1

Yes-associated protein 1

Synonyms: YAP YAP2 YAP65 YKI
UniProtKB ID: P46937, B4DTY1, Q7Z574, Q8IUY9
Gene ID:
Human(10413) Summary: This gene encodes the human ortholog of chicken YAP protein which binds to the SH3 domain of the Yes proto-oncogene product. This protein contains a WW domain that is found in various structural, regulatory and signaling molecules in yeast, nematode, and mammals, and may be involved in protein-protein interaction. [provided by RefSeq, Jul 2008]
Mouse(22601) yes-associated protein 1
Rat(363014) yes-associated protein 1
Zebrafish(561411) Yes-associated protein 1
dog(479465) Yes-associated protein 1
chicken(396171) Yes-associated protein 1
Horse(100068834) Yes-associated protein 1
domestic cat(101101408) Yes-associated protein 1
cow(100336629) Yes-associated protein 1
sheep(100913160) Yes-associated protein 1
domestic guinea pig(100726570) Yes-associated protein 1
naked mole-rat(101699461) Yes-associated protein 1
219 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4504068 Anti-phospho-YAP (pSer127) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4301450 Anti-phospho-YAP (pSer127) antibody produced in rabbit affinity isolated antibody human, mouse, rat
western blot pricing
SAB1305603 ANTI-PHOSPHO-YAP(S127) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
pricing
Y4645 Anti-phospho-YAP1 (pTyr357) antibody produced in rabbit ~1.5 mg/mL, affinity isolated antibody, buffered aqueous solution human
immunofluorescence, western blot pricing
SAB1305751 ANTI-YAP (CENTER S127) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB4500094 Anti-YAP antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
SAB4500095 Anti-YAP antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, western blot pricing
Y4770 Anti-YAP1 (C-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB2501938 Anti-YAP1 antibody produced in goat affinity isolated antibody, buffered aqueous solution rat, canine, human, mouse
ELISA, western blot pricing
SAB2108066 Anti-YAP1 antibody produced in rabbit affinity isolated antibody human, zebrafish, rat, rabbit, mouse, horse
immunohistochemistry, western blot pricing
AV50530 Anti-YAP1 antibody produced in rabbit affinity isolated antibody, lyophilized powder zebrafish, human, horse, rabbit, chicken, rat, mouse
western blot pricing
HPA038885 Anti-YAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
Y0771 Monoclonal Anti-phospho-YAP1 (pTyr357) antibody produced in mouse ~1.0 mg/mL, clone PYP-76, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
WH0010413M1 Monoclonal Anti-YAP1 antibody produced in mouse clone 2F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1404823 Monoclonal Anti-YAP1 antibody produced in mouse clone 2H1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006106 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006106 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006106 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009534 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009534 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009534 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006106 Rosetta Predictions human pricing
NM_001034002 Rosetta Predictions rat pricing
NM_009534 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006106 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182402 predicted 1257
2 SASI_Hs01_00182403 predicted 621
3 SASI_Hs01_00182404 predicted 1301
4 SASI_Hs01_00182405 predicted 715
5 SASI_Hs01_00182406 predicted 449
6 SASI_Hs01_00182407 predicted 1628
7 SASI_Hs01_00182408 predicted 1422
8 SASI_Hs01_00182409 predicted 1619
9 SASI_Hs01_00182410 predicted 805
10 SASI_Hs01_00182411 predicted 719
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034002 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114054 predicted 1088
2 SASI_Rn02_00203876 predicted 1124
3 SASI_Rn01_00114055 predicted 1093
4 SASI_Rn01_00114056 predicted 896
5 SASI_Rn01_00114057 predicted 1071
6 SASI_Rn01_00114059 predicted 1093
7 SASI_Rn01_00114060 predicted 909
8 SASI_Rn02_00203877 predicted 1127
9 SASI_Rn01_00114061 predicted 681
10 SASI_Rn01_00114062 predicted 929
11 SASI_Rn01_00114058 predicted 513
12 SASI_Rn01_00114063 predicted 1077
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009534 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022140 predicted 1579
2 SASI_Mm01_00022141 predicted 1238
3 SASI_Mm01_00022142 predicted 702
4 SASI_Mm01_00022143 predicted 1264
5 SASI_Mm02_00316360 predicted 704
6 SASI_Mm01_00022146 predicted 689
7 SASI_Mm01_00022147 predicted 711
8 SASI_Mm01_00022148 predicted 1672
9 SASI_Mm02_00316361 predicted 881
10 SASI_Mm02_00316362 predicted 1211
11 SASI_Mm01_00022144 predicted 1104
12 SASI_Mm01_00022145 predicted 1362
13 SASI_Mm01_00022149 predicted 643
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006106
VALIDATED
YAP1 MISSION shRNA Bacterial Glycerol Stock
Yes-associated protein 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1494s21c1
Sequence:CCGGCAGGTGATACTATCAACCAAACTCGAGTTTGGTTGATAGTATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-2049s21c1
Sequence:CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1354s21c1
Sequence:CCGGGACCAATAGCTCAGATCCTTTCTCGAGAAAGGATCTGAGCTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1694s21c1
Sequence:CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1928s1c1
Sequence:CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1233s1c1
Sequence:CCGGGACCAATAGCTCAGATCCTTTCTCGAGAAAGGATCTGAGCTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1232s1c1
Sequence:CCGGCGACCAATAGCTCAGATCCTTCTCGAGAAGGATCTGAGCTATTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1373s1c1
Sequence:CCGGCAGGTGATACTATCAACCAAACTCGAGTTTGGTTGATAGTATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1573s1c1
Sequence:CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006106
VALIDATED
YAP1 MISSION shRNA shRNA Plasmid DNA
Yes-associated protein 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1494s21c1
Sequence:CCGGCAGGTGATACTATCAACCAAACTCGAGTTTGGTTGATAGTATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-2049s21c1
Sequence:CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1354s21c1
Sequence:CCGGGACCAATAGCTCAGATCCTTTCTCGAGAAAGGATCTGAGCTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1694s21c1
Sequence:CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1928s1c1
Sequence:CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1233s1c1
Sequence:CCGGGACCAATAGCTCAGATCCTTTCTCGAGAAAGGATCTGAGCTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1232s1c1
Sequence:CCGGCGACCAATAGCTCAGATCCTTCTCGAGAAGGATCTGAGCTATTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1373s1c1
Sequence:CCGGCAGGTGATACTATCAACCAAACTCGAGTTTGGTTGATAGTATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1573s1c1
Sequence:CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006106
VALIDATED
YAP1 MISSION shRNA Lentiviral Transduction Particles
Yes-associated protein 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1494s21c1
Sequence:CCGGCAGGTGATACTATCAACCAAACTCGAGTTTGGTTGATAGTATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300282    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-2049s21c1
Sequence:CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1354s21c1
Sequence:CCGGGACCAATAGCTCAGATCCTTTCTCGAGAAAGGATCTGAGCTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006106.3-1694s21c1
Sequence:CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107265    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1928s1c1
Sequence:CCGGCCCAGTTAAATGTTCACCAATCTCGAGATTGGTGAACATTTAACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107268    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1233s1c1
Sequence:CCGGGACCAATAGCTCAGATCCTTTCTCGAGAAAGGATCTGAGCTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1232s1c1
Sequence:CCGGCGACCAATAGCTCAGATCCTTCTCGAGAAGGATCTGAGCTATTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107267    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1373s1c1
Sequence:CCGGCAGGTGATACTATCAACCAAACTCGAGTTTGGTTGATAGTATCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006106.2-1573s1c1
Sequence:CCGGGCCACCAAGCTAGATAAAGAACTCGAGTTCTTTATCTAGCTTGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009534
VALIDATED
YAP1 MISSION shRNA Bacterial Glycerol Stock
Yes-associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000238435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009534.2-3032s21c1
Sequence:CCGGATGTGTCTCCAGGAGTAATAACTCGAGTTATTACTCCTGGAGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-344s21c1
Sequence:CCGGACTTGGAGGCGCTCTTCAATGCTCGAGCATTGAAGAGCGCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009534.2-1051s21c1
Sequence:CCGGTCCAACCAGCAGCAGCAAATACTCGAGTATTTGCTGCTGCTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-1531s21c1
Sequence:CCGGGAAGCGCTGAGTTCCGAAATCCTCGAGGATTTCGGAACTCAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-1226s21c1
Sequence:CCGGTGAGAACAATGACAACCAATACTCGAGTATTGGTTGTCATTGTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-1107s1c1
Sequence:CCGGGCGGTTGAAACAACAGGAATTCTCGAGAATTCCTGTTGTTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-704s1c1
Sequence:CCGGCTGGTCAAAGATACTTCTTAACTCGAGTTAAGAAGTATCTTTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009534.1-1108s1c1
Sequence:CCGGCGGTTGAAACAACAGGAATTACTCGAGTAATTCCTGTTGTTTCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009534.1-1824s1c1
Sequence:CCGGGCAGACAGATTCCTTTGTTAACTCGAGTTAACAAAGGAATCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-1577s1c1
Sequence:CCGGCCACCAAGCTAGATAAAGAAACTCGAGTTTCTTTATCTAGCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009534
VALIDATED
YAP1 MISSION shRNA shRNA Plasmid DNA
Yes-associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000238435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009534.2-3032s21c1
Sequence:CCGGATGTGTCTCCAGGAGTAATAACTCGAGTTATTACTCCTGGAGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-344s21c1
Sequence:CCGGACTTGGAGGCGCTCTTCAATGCTCGAGCATTGAAGAGCGCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009534.2-1051s21c1
Sequence:CCGGTCCAACCAGCAGCAGCAAATACTCGAGTATTTGCTGCTGCTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-1531s21c1
Sequence:CCGGGAAGCGCTGAGTTCCGAAATCCTCGAGGATTTCGGAACTCAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-1226s21c1
Sequence:CCGGTGAGAACAATGACAACCAATACTCGAGTATTGGTTGTCATTGTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-1107s1c1
Sequence:CCGGGCGGTTGAAACAACAGGAATTCTCGAGAATTCCTGTTGTTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-704s1c1
Sequence:CCGGCTGGTCAAAGATACTTCTTAACTCGAGTTAAGAAGTATCTTTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009534.1-1108s1c1
Sequence:CCGGCGGTTGAAACAACAGGAATTACTCGAGTAATTCCTGTTGTTTCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009534.1-1824s1c1
Sequence:CCGGGCAGACAGATTCCTTTGTTAACTCGAGTTAACAAAGGAATCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-1577s1c1
Sequence:CCGGCCACCAAGCTAGATAAAGAAACTCGAGTTTCTTTATCTAGCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009534
VALIDATED
YAP1 MISSION shRNA Lentiviral Transduction Particles
Yes-associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000238435    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009534.2-3032s21c1
Sequence:CCGGATGTGTCTCCAGGAGTAATAACTCGAGTTATTACTCCTGGAGACACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-344s21c1
Sequence:CCGGACTTGGAGGCGCTCTTCAATGCTCGAGCATTGAAGAGCGCCTCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238433    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009534.2-1051s21c1
Sequence:CCGGTCCAACCAGCAGCAGCAAATACTCGAGTATTTGCTGCTGCTGGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-1531s21c1
Sequence:CCGGGAAGCGCTGAGTTCCGAAATCCTCGAGGATTTCGGAACTCAGCGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009534.2-1226s21c1
Sequence:CCGGTGAGAACAATGACAACCAATACTCGAGTATTGGTTGTCATTGTTCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-1107s1c1
Sequence:CCGGGCGGTTGAAACAACAGGAATTCTCGAGAATTCCTGTTGTTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-704s1c1
Sequence:CCGGCTGGTCAAAGATACTTCTTAACTCGAGTTAAGAAGTATCTTTGACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009534.1-1108s1c1
Sequence:CCGGCGGTTGAAACAACAGGAATTACTCGAGTAATTCCTGTTGTTTCAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095864    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009534.1-1824s1c1
Sequence:CCGGGCAGACAGATTCCTTTGTTAACTCGAGTTAACAAAGGAATCTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009534.1-1577s1c1
Sequence:CCGGCCACCAAGCTAGATAAAGAAACTCGAGTTTCTTTATCTAGCTTGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks