EMAIL THIS PAGE TO A FRIEND

YARS2

tyrosyl-tRNA synthetase 2, mitochondrial

Synonyms: MLASA2 MT-TYRRS TYRRS
UniProtKB ID: Q9Y2Z4, D3DUW8, Q9H817
Gene ID:
Human(51067) Summary: This gene encodes a mitochondrial protein that catalyzes the attachment of tyrosine to tRNA(Tyr). Mutations in this gene are associated with myopathy with lactic acidosis and sideroblastic anemia type 2 (MLASA2). [provided by RefSeq, Jan 2011]
Mouse(70120) tyrosyl-tRNA synthetase 2 (mitochondrial)
Rat(287924) tyrosyl-tRNA synthetase 2 (mitochondrial)
Zebrafish(556702) tyrosyl-tRNA synthetase 2, mitochondrial
chicken(418131) tyrosyl-tRNA synthetase 2, mitochondrial
domestic cat(101091289) tyrosyl-tRNA synthetase 2, mitochondrial
Horse(100064921) tyrosyl-tRNA synthetase 2, mitochondrial
dog(486614) tyrosyl-tRNA synthetase 2, mitochondrial
cow(536956) tyrosyl-tRNA synthetase 2, mitochondrial
sheep(101104981) tyrosyl-tRNA synthetase 2, mitochondrial
domestic guinea pig(100728689) tyrosyl-tRNA synthetase 2, mitochondrial
naked mole-rat(101711336) tyrosyl-tRNA synthetase 2, mitochondrial
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198246 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198246 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198246 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015936 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001040436 Rosetta Predictions human pricing
NM_001009627 Rosetta Predictions rat pricing
NM_198246 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001040436 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00084338 predicted 1205
2 SASI_Hs02_00308963 predicted 1299
3 SASI_Hs01_00084340 predicted 804
4 SASI_Hs01_00084342 predicted 1433
5 SASI_Hs01_00084343 predicted 1283
6 SASI_Hs02_00308964 predicted 1551
7 SASI_Hs01_00084344 predicted 1278
8 SASI_Hs01_00084345 predicted 787
9 SASI_Hs01_00084346 predicted 518
10 SASI_Hs01_00084347 predicted 825
11 SASI_Hs01_00084339 predicted 1371
12 SASI_Hs01_00084341 predicted 322
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009627 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00103670 predicted 749
2 SASI_Rn01_00103671 predicted 907
3 SASI_Rn01_00103672 predicted 484
4 SASI_Rn01_00103673 predicted 1008
5 SASI_Rn01_00103674 predicted 1095
6 SASI_Rn02_00199637 predicted 719
7 SASI_Rn01_00103675 predicted 259
8 SASI_Rn02_00199638 predicted 959
9 SASI_Rn01_00103676 predicted 663
10 SASI_Rn01_00103677 predicted 736
11 SASI_Rn01_00103678 predicted 1134
12 SASI_Rn01_00103679 predicted 729
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198246 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172749 predicted 715
2 SASI_Mm01_00172750 predicted 1095
3 SASI_Mm01_00172751 predicted 719
4 SASI_Mm01_00172752 predicted 662
5 SASI_Mm01_00172753 predicted 1335
6 SASI_Mm01_00172754 predicted 1316
7 SASI_Mm01_00172755 predicted 1038
8 SASI_Mm01_00172756 predicted 658
9 SASI_Mm01_00172757 predicted 748
10 SASI_Mm01_00172758 predicted 723
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198246
VALIDATED
YARS2 MISSION shRNA Bacterial Glycerol Stock
tyrosyl-tRNA synthetase 2, mitochondrial
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-790s21c1
Sequence:CCGGGAATCACTGTACCTCTAATTACTCGAGTAATTAGAGGTACAGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1256s21c1
Sequence:CCGGTCGAGGGTATCGGATGATAACCTCGAGGTTATCATCCGATACCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1278s21c1
Sequence:CCGGGAAGGTGGAGTCAGTATAAATCTCGAGATTTATACTGACTCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1355s1c1
Sequence:CCGGGAATGGACTTTCCTTACTTAACTCGAGTTAAGTAAGGAAAGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1328s21c1
Sequence:CCGGTCTAGTAATTGGACAACATATCTCGAGATATGTTGTCCAATTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198246.1-876s21c1
Sequence:CCGGACATCACCGTTTGAACTTTATCTCGAGATAAAGTTCAAACGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1210s1c1
Sequence:CCGGGTGTCATAGACACATGCCGTACTCGAGTACGGCATGTGTCTATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1326s1c1
Sequence:CCGGGTTCTAGTAATTGGACAACATCTCGAGATGTTGTCCAATTACTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1014s1c1
Sequence:CCGGCGAGTTGCTCAGAAACGACTTCTCGAGAAGTCGTTTCTGAGCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198246
VALIDATED
YARS2 MISSION shRNA shRNA Plasmid DNA
tyrosyl-tRNA synthetase 2, mitochondrial
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-790s21c1
Sequence:CCGGGAATCACTGTACCTCTAATTACTCGAGTAATTAGAGGTACAGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1256s21c1
Sequence:CCGGTCGAGGGTATCGGATGATAACCTCGAGGTTATCATCCGATACCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1278s21c1
Sequence:CCGGGAAGGTGGAGTCAGTATAAATCTCGAGATTTATACTGACTCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1355s1c1
Sequence:CCGGGAATGGACTTTCCTTACTTAACTCGAGTTAAGTAAGGAAAGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1328s21c1
Sequence:CCGGTCTAGTAATTGGACAACATATCTCGAGATATGTTGTCCAATTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198246.1-876s21c1
Sequence:CCGGACATCACCGTTTGAACTTTATCTCGAGATAAAGTTCAAACGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1210s1c1
Sequence:CCGGGTGTCATAGACACATGCCGTACTCGAGTACGGCATGTGTCTATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1326s1c1
Sequence:CCGGGTTCTAGTAATTGGACAACATCTCGAGATGTTGTCCAATTACTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1014s1c1
Sequence:CCGGCGAGTTGCTCAGAAACGACTTCTCGAGAAGTCGTTTCTGAGCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198246
VALIDATED
YARS2 MISSION shRNA Lentiviral Transduction Particles
tyrosyl-tRNA synthetase 2, mitochondrial
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250670    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-790s21c1
Sequence:CCGGGAATCACTGTACCTCTAATTACTCGAGTAATTAGAGGTACAGTGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1256s21c1
Sequence:CCGGTCGAGGGTATCGGATGATAACCTCGAGGTTATCATCCGATACCCTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1278s21c1
Sequence:CCGGGAAGGTGGAGTCAGTATAAATCTCGAGATTTATACTGACTCCACCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215482    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1355s1c1
Sequence:CCGGGAATGGACTTTCCTTACTTAACTCGAGTTAAGTAAGGAAAGTCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_198246.1-1328s21c1
Sequence:CCGGTCTAGTAATTGGACAACATATCTCGAGATATGTTGTCCAATTACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198246.1-876s21c1
Sequence:CCGGACATCACCGTTTGAACTTTATCTCGAGATAAAGTTCAAACGGTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201793    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1210s1c1
Sequence:CCGGGTGTCATAGACACATGCCGTACTCGAGTACGGCATGTGTCTATGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191500    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1326s1c1
Sequence:CCGGGTTCTAGTAATTGGACAACATCTCGAGATGTTGTCCAATTACTAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201516    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_198246.1-1014s1c1
Sequence:CCGGCGAGTTGCTCAGAAACGACTTCTCGAGAAGTCGTTTCTGAGCAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015936
VALIDATED
YARS2 MISSION shRNA Bacterial Glycerol Stock
tyrosyl-tRNA synthetase 2, mitochondrial
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-1507s1c1
Sequence:CCGGCCAGAACTTAGACCTTTGCTTCTCGAGAAGCAAAGGTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015936.1-758s1c1
Sequence:CCGGGTCCGGATATGAGTTCATCAACTCGAGTTGATGAACTCATATCCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-1216s1c1
Sequence:CCGGCTGGAACAAGTGTCCTAGATACTCGAGTATCTAGGACACTTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015936.1-1706s1c1
Sequence:CCGGGAAGAGAAAGAAATGCTGCTTCTCGAGAAGCAGCATTTCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-980s1c1
Sequence:CCGGCCCAGAGATTGATCATATCATCTCGAGATGATATGATCAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015936.1-1445s1c1
Sequence:CCGGCCTTCTGGTTGTCCAAATAAACTCGAGTTTATTTGGACAACCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015936.1-49s1c1
Sequence:CCGGGTACCCTAAATCTCTCAGTATCTCGAGATACTGAGAGATTTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015936
VALIDATED
YARS2 MISSION shRNA shRNA Plasmid DNA
tyrosyl-tRNA synthetase 2, mitochondrial
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-1507s1c1
Sequence:CCGGCCAGAACTTAGACCTTTGCTTCTCGAGAAGCAAAGGTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015936.1-758s1c1
Sequence:CCGGGTCCGGATATGAGTTCATCAACTCGAGTTGATGAACTCATATCCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-1216s1c1
Sequence:CCGGCTGGAACAAGTGTCCTAGATACTCGAGTATCTAGGACACTTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015936.1-1706s1c1
Sequence:CCGGGAAGAGAAAGAAATGCTGCTTCTCGAGAAGCAGCATTTCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-980s1c1
Sequence:CCGGCCCAGAGATTGATCATATCATCTCGAGATGATATGATCAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015936.1-1445s1c1
Sequence:CCGGCCTTCTGGTTGTCCAAATAAACTCGAGTTTATTTGGACAACCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015936.1-49s1c1
Sequence:CCGGGTACCCTAAATCTCTCAGTATCTCGAGATACTGAGAGATTTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015936
VALIDATED
YARS2 MISSION shRNA Lentiviral Transduction Particles
tyrosyl-tRNA synthetase 2, mitochondrial
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149593    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-1507s1c1
Sequence:CCGGCCAGAACTTAGACCTTTGCTTCTCGAGAAGCAAAGGTCTAAGTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149028    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015936.1-758s1c1
Sequence:CCGGGTCCGGATATGAGTTCATCAACTCGAGTTGATGAACTCATATCCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-1216s1c1
Sequence:CCGGCTGGAACAAGTGTCCTAGATACTCGAGTATCTAGGACACTTGTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148238    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015936.1-1706s1c1
Sequence:CCGGGAAGAGAAAGAAATGCTGCTTCTCGAGAAGCAGCATTTCTTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_015936.1-980s1c1
Sequence:CCGGCCCAGAGATTGATCATATCATCTCGAGATGATATGATCAATCTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146614    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_015936.1-1445s1c1
Sequence:CCGGCCTTCTGGTTGTCCAAATAAACTCGAGTTTATTTGGACAACCAGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015936.1-49s1c1
Sequence:CCGGGTACCCTAAATCTCTCAGTATCTCGAGATACTGAGAGATTTAGGGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks