EMAIL THIS PAGE TO A FRIEND

YARS

tyrosyl-tRNA synthetase

Synonyms: CMTDIC TYRRS YRS YTS
UniProtKB ID: P54577, B3KWK4, D3DPQ4, O43276, Q53EN1
Gene ID:
Human(8565) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAs, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Tyrosyl-tRNA synthetase belongs to the class I tRNA synthetase family. Cytokine activities have also been observed for the human tyrosyl-tRNA synthetase, after it is split into two parts, an N-terminal fragment that harbors the catalytic site and a C-terminal fragment found only in the mammalian enzyme. The N-terminal fragment is an interleukin-8-like cytokine, whereas the released C-terminal fragment is an EMAP II-like cytokine. [provided by RefSeq, Jul 2008]
Mouse(107271) tyrosyl-tRNA synthetase
Rat(313047) tyrosyl-tRNA synthetase
Zebrafish(368235) tyrosyl-tRNA synthetase
domestic cat(101080309) tyrosyl-tRNA synthetase
Horse(100070128) tyrosyl-tRNA synthetase
dog(478148) tyrosyl-tRNA synthetase
chicken(419666) tyrosyl-tRNA synthetase
naked mole-rat(101723833) tyrosyl-tRNA synthetase
Domestic Rabbit(100353312) tyrosyl-tRNA synthetase
domestic guinea pig(100722635) tyrosyl-tRNA synthetase
cow(281581) tyrosyl-tRNA synthetase
sheep(101111862) tyrosyl-tRNA synthetase
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003680 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003680 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003680 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134151 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134151 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134151 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU010561 MISSION® esiRNA esiRNA targeting human YARS (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003680 Rosetta Predictions human pricing
NM_001025696 Rosetta Predictions rat pricing
NM_134151 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003680 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00203064 predicted 1067
2 SASI_Hs01_00203065 predicted 1176
3 SASI_Hs01_00203066 predicted 1291
4 SASI_Hs02_00336085 predicted 1607
5 SASI_Hs01_00203070 predicted 1476
6 SASI_Hs01_00203071 predicted 1324
7 SASI_Hs02_00336086 predicted 1732
8 SASI_Hs02_00336087 predicted 2124
9 SASI_Hs01_00203072 predicted 1019
10 SASI_Hs01_00203073 predicted 1163
11 SASI_Hs01_00203067 predicted 962
12 SASI_Hs01_00203068 predicted 2120
13 SASI_Hs01_00203069 predicted 2134
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025696 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00070936 predicted 653
2 SASI_Rn01_00070937 predicted 315
3 SASI_Rn01_00070938 predicted 1037
4 SASI_Rn01_00070939 predicted 1541
5 SASI_Rn02_00203315 predicted 356
6 SASI_Rn01_00070941 predicted 459
7 SASI_Rn01_00070942 predicted 1662
8 SASI_Rn01_00070943 predicted 960
9 SASI_Rn01_00070944 predicted 1064
10 SASI_Rn01_00070945 predicted 1452
11 SASI_Rn01_00070940 predicted 693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134151 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339417 predicted 1571
2 SASI_Mm01_00122776 predicted 1736
3 SASI_Mm01_00122777 predicted 1609
4 SASI_Mm01_00122778 predicted 1038
5 SASI_Mm01_00122779 predicted 893
6 SASI_Mm01_00122780 predicted 494
7 SASI_Mm01_00122781 predicted 490
8 SASI_Mm01_00122782 predicted 1883
9 SASI_Mm01_00122783 predicted 534
10 SASI_Mm01_00122784 predicted 955
11 SASI_Mm01_00122775 predicted 1221
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003680
VALIDATED
YARS MISSION shRNA Bacterial Glycerol Stock
tyrosyl-tRNA synthetase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003680.2-1385s1c2
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1065s1c1
Sequence:CCGGCGAGTCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003680.2-1541s1c1
Sequence:CCGGGCCAGGAAATGTGGAGAACAACTCGAGTTGTTCTCCACATTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003680.2-1385s1c1
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1734s1c1
Sequence:CCGGGCACTGAACAAGTTGCTGGATCTCGAGATCCAGCAACTTGTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1299s1c1
Sequence:CCGGGCTTTGGATGAAGAGTATTTACTCGAGTAAATACTCTTCATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1065s21c1
Sequence:CCGGCGAGTCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003680.3-2674s21c1
Sequence:CCGGTTATGCCACAGTCCTTATAATCTCGAGATTATAAGGACTGTGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003680.3-1299s21c1
Sequence:CCGGGCTTTGGATGAAGAGTATTTACTCGAGTAAATACTCTTCATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1136s21c1
Sequence:CCGGGTTCATCAAAGGCACTGATTACTCGAGTAATCAGTGCCTTTGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000307763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1385s21c1
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003680
VALIDATED
YARS MISSION shRNA shRNA Plasmid DNA
tyrosyl-tRNA synthetase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003680.2-1385s1c2
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1065s1c1
Sequence:CCGGCGAGTCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003680.2-1541s1c1
Sequence:CCGGGCCAGGAAATGTGGAGAACAACTCGAGTTGTTCTCCACATTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003680.2-1385s1c1
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1734s1c1
Sequence:CCGGGCACTGAACAAGTTGCTGGATCTCGAGATCCAGCAACTTGTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1299s1c1
Sequence:CCGGGCTTTGGATGAAGAGTATTTACTCGAGTAAATACTCTTCATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1065s21c1
Sequence:CCGGCGAGTCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003680.3-2674s21c1
Sequence:CCGGTTATGCCACAGTCCTTATAATCTCGAGATTATAAGGACTGTGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003680.3-1299s21c1
Sequence:CCGGGCTTTGGATGAAGAGTATTTACTCGAGTAAATACTCTTCATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1136s21c1
Sequence:CCGGGTTCATCAAAGGCACTGATTACTCGAGTAATCAGTGCCTTTGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000307763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1385s21c1
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003680
VALIDATED
YARS MISSION shRNA Lentiviral Transduction Particles
tyrosyl-tRNA synthetase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003680.2-1385s1c2
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1065s1c1
Sequence:CCGGCGAGTCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_003680.2-1541s1c1
Sequence:CCGGGCCAGGAAATGTGGAGAACAACTCGAGTTGTTCTCCACATTTCCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045636    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_003680.2-1385s1c1
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045637    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1734s1c1
Sequence:CCGGGCACTGAACAAGTTGCTGGATCTCGAGATCCAGCAACTTGTTCAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A3
TRC Version: 1 Clone ID:NM_003680.2-1299s1c1
Sequence:CCGGGCTTTGGATGAAGAGTATTTACTCGAGTAAATACTCTTCATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310151    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1065s21c1
Sequence:CCGGCGAGTCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303340    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003680.3-2674s21c1
Sequence:CCGGTTATGCCACAGTCCTTATAATCTCGAGATTATAAGGACTGTGGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291656    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003680.3-1299s21c1
Sequence:CCGGGCTTTGGATGAAGAGTATTTACTCGAGTAAATACTCTTCATCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1136s21c1
Sequence:CCGGGTTCATCAAAGGCACTGATTACTCGAGTAATCAGTGCCTTTGATGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000307763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_003680.3-1385s21c1
Sequence:CCGGCCCTGCACTTGGCTATTCAAACTCGAGTTTGAATAGCCAAGTGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134151
VALIDATED
YARS MISSION shRNA Bacterial Glycerol Stock
tyrosyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000075723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-2312s1c1
Sequence:CCGGGCCACTGTCAAGTTCAAATAACTCGAGTTATTTGAACTTGACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-1614s1c1
Sequence:CCGGCGTCTCCTGTAAATCACTAAACTCGAGTTTAGTGATTTACAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-397s1c1
Sequence:CCGGCCCTTGGAGAAGCTCAAGTTTCTCGAGAAACTTGAGCTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-343s1c1
Sequence:CCGGCGAACCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000075724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-96s1c1
Sequence:CCGGGCTGCATCTTATCACCCGGAACTCGAGTTCCGGGTGATAAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134151
VALIDATED
YARS MISSION shRNA shRNA Plasmid DNA
tyrosyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000075723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-2312s1c1
Sequence:CCGGGCCACTGTCAAGTTCAAATAACTCGAGTTATTTGAACTTGACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-1614s1c1
Sequence:CCGGCGTCTCCTGTAAATCACTAAACTCGAGTTTAGTGATTTACAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-397s1c1
Sequence:CCGGCCCTTGGAGAAGCTCAAGTTTCTCGAGAAACTTGAGCTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-343s1c1
Sequence:CCGGCGAACCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000075724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-96s1c1
Sequence:CCGGGCTGCATCTTATCACCCGGAACTCGAGTTCCGGGTGATAAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134151
VALIDATED
YARS MISSION shRNA Lentiviral Transduction Particles
tyrosyl-tRNA synthetase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000075723    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-2312s1c1
Sequence:CCGGGCCACTGTCAAGTTCAAATAACTCGAGTTATTTGAACTTGACAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-1614s1c1
Sequence:CCGGCGTCTCCTGTAAATCACTAAACTCGAGTTTAGTGATTTACAGGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-397s1c1
Sequence:CCGGCCCTTGGAGAAGCTCAAGTTTCTCGAGAAACTTGAGCTTCTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-343s1c1
Sequence:CCGGCGAACCAGTTACTATGAGAATCTCGAGATTCTCATAGTAACTGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000075724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_134151.2-96s1c1
Sequence:CCGGGCTGCATCTTATCACCCGGAACTCGAGTTCCGGGTGATAAGATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks