EMAIL THIS PAGE TO A FRIEND

YBEY

ybeY metallopeptidase (putative)

Synonyms: C21orf57
UniProtKB ID: P58557, B7WPA9, B7WPF7, D3DSN2
Gene ID:
Mouse(216119) ybeY metallopeptidase
Rat(361822) ybeY metallopeptidase
cow(768063) ybeY metallopeptidase (putative)
sheep(101112692) ybeY metallopeptidase (putative)
domestic guinea pig(100727459) ybeY metallopeptidase (putative)
naked mole-rat(101715532) ybeY metallopeptidase (putative)
Zebrafish(321718) ybeY metallopeptidase
domestic cat(101099741) ybeY metallopeptidase (putative)
dog(606842) ybeY metallopeptidase (putative)
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001006114 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001006114 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001006114 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001006114 Rosetta Predictions human pricing
NM_058181 Rosetta Predictions human pricing
NM_001108529 Rosetta Predictions rat pricing
NM_172550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001006114 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061910 predicted 385
2 SASI_Hs01_00061911 predicted 245
3 SASI_Hs01_00061912 predicted 525
4 SASI_Hs01_00061913 predicted 312
5 SASI_Hs01_00061914 predicted 238
6 SASI_Hs01_00061915 predicted 525
7 SASI_Hs01_00061917 predicted 280
8 SASI_Hs01_00061919 predicted 284
9 SASI_Hs02_00305066 predicted 380
10 SASI_Hs02_00305067 predicted 307
11 SASI_Hs01_00061916 predicted 537
12 SASI_Hs01_00061918 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_058181 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236651 predicted 709
2 SASI_Hs01_00236652 predicted 482
3 SASI_Hs01_00236653 predicted 572
4 SASI_Hs01_00236654 predicted 632
5 SASI_Hs01_00236655 predicted 493
6 SASI_Hs01_00236656 predicted 559
7 SASI_Hs01_00236657 predicted 484
8 SASI_Hs01_00236658 predicted 600
9 SASI_Hs01_00236659 predicted 702
10 SASI_Hs01_00236660 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108529 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239539 predicted 892
2 SASI_Rn02_00239540 predicted 237
3 SASI_Rn02_00239541 predicted 900
4 SASI_Rn02_00239542 predicted 898
5 SASI_Rn02_00239543 predicted 833
6 SASI_Rn02_00239544 predicted 356
7 SASI_Rn02_00239545 predicted 688
8 SASI_Rn02_00239546 predicted 789
9 SASI_Rn02_00239547 predicted 746
10 SASI_Rn02_00239548 predicted 697
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198174 predicted 599
2 SASI_Mm01_00198176 predicted 488
3 SASI_Mm01_00198177 predicted 843
4 SASI_Mm01_00198178 predicted 1323
5 SASI_Mm01_00198179 predicted 603
6 SASI_Mm01_00198180 predicted 527
7 SASI_Mm01_00198181 predicted 412
8 SASI_Mm01_00198182 predicted 597
9 SASI_Mm01_00198183 predicted 1217
10 SASI_Mm02_00344161 predicted 476
11 SASI_Mm01_00198175 predicted 752
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172550
YBEY MISSION shRNA Bacterial Glycerol Stock
ybeY metallopeptidase (putative)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000183639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-614s1c1
Sequence:CCGGGATTATAATCTGGGAGACATTCTCGAGAATGTCTCCCAGATTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-548s1c1
Sequence:CCGGGTGCTTTCTTTCTCATTTCATCTCGAGATGAAATGAGAAAGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-416s1c1
Sequence:CCGGCTTCGCAGGAAGATGGATTTACTCGAGTAAATCCATCTTCCTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-608s1c1
Sequence:CCGGCCGGATGATTATAATCTGGGACTCGAGTCCCAGATTATAATCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172550
YBEY MISSION shRNA shRNA Plasmid DNA
ybeY metallopeptidase (putative)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000183639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-614s1c1
Sequence:CCGGGATTATAATCTGGGAGACATTCTCGAGAATGTCTCCCAGATTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-548s1c1
Sequence:CCGGGTGCTTTCTTTCTCATTTCATCTCGAGATGAAATGAGAAAGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-416s1c1
Sequence:CCGGCTTCGCAGGAAGATGGATTTACTCGAGTAAATCCATCTTCCTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-608s1c1
Sequence:CCGGCCGGATGATTATAATCTGGGACTCGAGTCCCAGATTATAATCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172550
YBEY MISSION shRNA Lentiviral Transduction Particles
ybeY metallopeptidase (putative)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000183639    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-614s1c1
Sequence:CCGGGATTATAATCTGGGAGACATTCTCGAGAATGTCTCCCAGATTATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-548s1c1
Sequence:CCGGGTGCTTTCTTTCTCATTTCATCTCGAGATGAAATGAGAAAGAAAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178831    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-416s1c1
Sequence:CCGGCTTCGCAGGAAGATGGATTTACTCGAGTAAATCCATCTTCCTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179001    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172550.2-608s1c1
Sequence:CCGGCCGGATGATTATAATCTGGGACTCGAGTCCCAGATTATAATCATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001006114
VALIDATED
YBEY MISSION shRNA Bacterial Glycerol Stock
ybeY metallopeptidase (putative)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006114.1-758s1c1
Sequence:CCGGGCTGCCAGAAGTACAGAAGTTCTCGAGAACTTCTGTACTTCTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-354s1c1
Sequence:CCGGCCAGATGACTACAATTTGGGACTCGAGTCCCAAATTGTAGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006114.1-393s1c1
Sequence:CCGGGAGTATATCTTCCATCAGTGTCTCGAGACACTGATGGAAGATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006114.1-166s1c1
Sequence:CCGGGCAGTAAGATCGAGATTGTAACTCGAGTTACAATCTCGATCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006114.1-318s1c1
Sequence:CCGGCATCTGAAAGCAGGTGAATTTCTCGAGAAATTCACCTGCTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-221s1c1
Sequence:CCGGGATCATCTGTGTTGACAACAACTCGAGTTGTTGTCAACACAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006114.1-360s1c1
Sequence:CCGGGACTACAATTTGGGAGACATTCTCGAGAATGTCTCCCAAATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006114.1-306s1c1
Sequence:CCGGCCATTTCATGAGCATCTGAAACTCGAGTTTCAGATGCTCATGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-383s1c1
Sequence:CCGGCCTAGGAGTGGAGTATATCTTCTCGAGAAGATATACTCCACTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006114.1-162s1c1
Sequence:CCGGCTTCGCAGTAAGATCGAGATTCTCGAGAATCTCGATCTTACTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006114.1-723s1c1
Sequence:CCGGGCTAACACAGACCTGCTGAATCTCGAGATTCAGCAGGTCTGTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006114.1-799s1c1
Sequence:CCGGGATCTGTTTCTCCTCAGTGTACTCGAGTACACTGAGGAGAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006114.1-261s21c1
Sequence:CCGGAGAATCTACAGAGATAGAAATCTCGAGATTTCTATCTCTGTAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001006114
VALIDATED
YBEY MISSION shRNA shRNA Plasmid DNA
ybeY metallopeptidase (putative)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006114.1-758s1c1
Sequence:CCGGGCTGCCAGAAGTACAGAAGTTCTCGAGAACTTCTGTACTTCTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-354s1c1
Sequence:CCGGCCAGATGACTACAATTTGGGACTCGAGTCCCAAATTGTAGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006114.1-393s1c1
Sequence:CCGGGAGTATATCTTCCATCAGTGTCTCGAGACACTGATGGAAGATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006114.1-166s1c1
Sequence:CCGGGCAGTAAGATCGAGATTGTAACTCGAGTTACAATCTCGATCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006114.1-318s1c1
Sequence:CCGGCATCTGAAAGCAGGTGAATTTCTCGAGAAATTCACCTGCTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-221s1c1
Sequence:CCGGGATCATCTGTGTTGACAACAACTCGAGTTGTTGTCAACACAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006114.1-360s1c1
Sequence:CCGGGACTACAATTTGGGAGACATTCTCGAGAATGTCTCCCAAATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006114.1-306s1c1
Sequence:CCGGCCATTTCATGAGCATCTGAAACTCGAGTTTCAGATGCTCATGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-383s1c1
Sequence:CCGGCCTAGGAGTGGAGTATATCTTCTCGAGAAGATATACTCCACTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006114.1-162s1c1
Sequence:CCGGCTTCGCAGTAAGATCGAGATTCTCGAGAATCTCGATCTTACTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006114.1-723s1c1
Sequence:CCGGGCTAACACAGACCTGCTGAATCTCGAGATTCAGCAGGTCTGTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006114.1-799s1c1
Sequence:CCGGGATCTGTTTCTCCTCAGTGTACTCGAGTACACTGAGGAGAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006114.1-261s21c1
Sequence:CCGGAGAATCTACAGAGATAGAAATCTCGAGATTTCTATCTCTGTAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001006114
VALIDATED
YBEY MISSION shRNA Lentiviral Transduction Particles
ybeY metallopeptidase (putative)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137931    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006114.1-758s1c1
Sequence:CCGGGCTGCCAGAAGTACAGAAGTTCTCGAGAACTTCTGTACTTCTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-354s1c1
Sequence:CCGGCCAGATGACTACAATTTGGGACTCGAGTCCCAAATTGTAGTCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133657    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006114.1-393s1c1
Sequence:CCGGGAGTATATCTTCCATCAGTGTCTCGAGACACTGATGGAAGATATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006114.1-166s1c1
Sequence:CCGGGCAGTAAGATCGAGATTGTAACTCGAGTTACAATCTCGATCTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001006114.1-318s1c1
Sequence:CCGGCATCTGAAAGCAGGTGAATTTCTCGAGAAATTCACCTGCTTTCAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-221s1c1
Sequence:CCGGGATCATCTGTGTTGACAACAACTCGAGTTGTTGTCAACACAGATGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134687    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006114.1-360s1c1
Sequence:CCGGGACTACAATTTGGGAGACATTCTCGAGAATGTCTCCCAAATTGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001006114.1-306s1c1
Sequence:CCGGCCATTTCATGAGCATCTGAAACTCGAGTTTCAGATGCTCATGAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135168    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001006114.1-383s1c1
Sequence:CCGGCCTAGGAGTGGAGTATATCTTCTCGAGAAGATATACTCCACTCCTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001006114.1-162s1c1
Sequence:CCGGCTTCGCAGTAAGATCGAGATTCTCGAGAATCTCGATCTTACTGCGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137721    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001006114.1-723s1c1
Sequence:CCGGGCTAACACAGACCTGCTGAATCTCGAGATTCAGCAGGTCTGTGTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136080    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001006114.1-799s1c1
Sequence:CCGGGATCTGTTTCTCCTCAGTGTACTCGAGTACACTGAGGAGAAACAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451688    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001006114.1-261s21c1
Sequence:CCGGAGAATCTACAGAGATAGAAATCTCGAGATTTCTATCTCTGTAGATTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks