EMAIL THIS PAGE TO A FRIEND

YBX1

Y box binding protein 1

Synonyms: BP-8 CSDA2 CSDB DBPB MDR-NF1 NSEP-1 NSEP1 YB-1 YB1
UniProtKB ID: P67809, P16990, P16991, Q14972, Q15325, Q5FVF0
Gene ID:
Mouse(22608) Y box protein 1
Rat(500538) Y box binding protein 1
Zebrafish(795398) Y box binding protein 1
dog(479011) Y box binding protein 1
chicken(386575) Y box binding protein 1
naked mole-rat(101724789) Y box binding protein 1
Domestic Rabbit(100009583) Y box binding protein 1
cow(287023) Y box binding protein 1
sheep(100048989) Y box binding protein 1
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV34395 Anti-NSEP1 (AB2) antibody produced in rabbit affinity isolated antibody rabbit, human, rat, canine, bovine, guinea pig, sheep, mouse, horse, rabbit
western blot pricing
SAB4504748 Anti-phospho-YB1 (pSer102) antibody produced in rabbit affinity isolated antibody rat, human, mouse
ELISA, western blot pricing
SAB4301376 Anti-phospho-YB1 (pSer102) antibody produced in rabbit affinity isolated antibody mouse, human, rat
western blot pricing
Y0396 Anti-YB-1 (C-terminal) antibody produced in rabbit ~1.0 mg/mL, affinity isolated antibody, buffered aqueous solution human, mouse, rat
immunofluorescence, immunoprecipitation, western blot pricing
Y0271 Anti-YB-1 (N-terminal) antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, human, mouse
western blot pricing
SAB1306009 ANTI-YB1 (YBX1)(N-TERMINAL) antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2103783 Anti-YBX1 antibody produced in rabbit affinity isolated antibody sheep, rabbit, guinea pig, rabbit, canine, mouse, rat, human, horse, bovine
western blot pricing
HPA040304 Anti-YBX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunofluorescence, immunohistochemistry, western blot pricing
HPA057159 Anti-YBX1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0004904M1 Monoclonal Anti-YBX1 antibody produced in mouse clone 4F12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404148 Monoclonal Anti-YBX1 antibody produced in mouse clone 4C7, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011732 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011732 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011732 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004559 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004559 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004559 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004559 Rosetta Predictions human pricing
NM_031563 Rosetta Predictions rat pricing
XM_001055707 Rosetta Predictions rat pricing
NM_011732 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004559 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00017064 predicted 771
2 SASI_Hs01_00017065 predicted 553
3 SASI_Hs01_00017066 predicted 457
4 SASI_Hs01_00017067 predicted 1133
5 SASI_Hs01_00017068 predicted 1148
6 SASI_Hs01_00017070 predicted 592
7 SASI_Hs02_00337882 predicted 851
8 SASI_Hs01_00017071 predicted 483
9 SASI_Hs01_00017072 predicted 1168
10 SASI_Hs01_00017073 predicted 560
11 SASI_Hs01_00017069 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031563 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00071528 predicted 951
2 SASI_Rn01_00071529 predicted 1075
3 SASI_Rn01_00071530 predicted 537
4 SASI_Rn01_00071531 predicted 525
5 SASI_Rn02_00264784 predicted 399
6 SASI_Rn01_00071532 predicted 680
7 SASI_Rn02_00264785 predicted 503
8 SASI_Rn01_00071533 predicted 659
9 SASI_Rn02_00264786 predicted 498
10 SASI_Rn01_00071537 predicted 872
11 SASI_Rn01_00071534 predicted 796
12 SASI_Rn01_00071535 predicted 518
13 SASI_Rn01_00071536 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00280708 predicted 959
2 SASI_Rn02_00280709 predicted 550
3 SASI_Rn02_00280710 predicted 538
4 SASI_Rn02_00280711 predicted 409
5 SASI_Rn02_00280712 predicted 690
6 SASI_Rn02_00280713 predicted 515
7 SASI_Rn02_00280714 predicted 667
8 SASI_Rn02_00280715 predicted 513
9 SASI_Rn02_00280716 predicted 883
10 SASI_Rn02_00280717 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011732 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179227 predicted 900
2 SASI_Mm01_00179228 predicted 1054
3 SASI_Mm01_00179229 predicted 981
4 SASI_Mm01_00179230 predicted 562
5 SASI_Mm01_00179231 predicted 1013
6 SASI_Mm01_00179232 predicted 554
7 SASI_Mm02_00321308 predicted 1586
8 SASI_Mm01_00179233 predicted 713
9 SASI_Mm02_00321309 predicted 1584
10 SASI_Mm01_00179234 predicted 739
11 SASI_Mm01_00179225 predicted 724
12 SASI_Mm01_00179226 predicted 560
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011732
VALIDATED
YBX1 MISSION shRNA Bacterial Glycerol Stock
Y box binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000348052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011732.2-1511s21c1
Sequence:CCGGCCTGTTAATAAAGGTCTTAAACTCGAGTTTAAGACCTTTATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-589s1c2
Sequence:CCGGGCGAAGGTTCCCACCTTACTACTCGAGTAGTAAGGTGGGAACCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011732.2-984s21c1
Sequence:CCGGGTATCGCCGAAACTTCAATTACTCGAGTAATTGAAGTTTCGGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011732.2-1021s21c1
Sequence:CCGGGAGAACCCTAAACCACAAGATCTCGAGATCTTGTGGTTTAGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011732.2-1132s21c1
Sequence:CCGGCATCTCTACCATCATCCGGTTCTCGAGAACCGGATGATGGTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011732.1-1007s1c1
Sequence:CCGGCATCTCTACCATCATCCGGTTCTCGAGAACCGGATGATGGTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-721s1c1
Sequence:CCGGACAGAATATGTATCGCCCTTACTCGAGTAAGGGCGATACATATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-859s1c1
Sequence:CCGGGTATCGCCGAAACTTCAATTACTCGAGTAATTGAAGTTTCGGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011732.1-896s1c1
Sequence:CCGGGAGAACCCTAAACCACAAGATCTCGAGATCTTGTGGTTTAGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011732
VALIDATED
YBX1 MISSION shRNA shRNA Plasmid DNA
Y box binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000348052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011732.2-1511s21c1
Sequence:CCGGCCTGTTAATAAAGGTCTTAAACTCGAGTTTAAGACCTTTATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-589s1c2
Sequence:CCGGGCGAAGGTTCCCACCTTACTACTCGAGTAGTAAGGTGGGAACCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011732.2-984s21c1
Sequence:CCGGGTATCGCCGAAACTTCAATTACTCGAGTAATTGAAGTTTCGGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011732.2-1021s21c1
Sequence:CCGGGAGAACCCTAAACCACAAGATCTCGAGATCTTGTGGTTTAGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011732.2-1132s21c1
Sequence:CCGGCATCTCTACCATCATCCGGTTCTCGAGAACCGGATGATGGTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011732.1-1007s1c1
Sequence:CCGGCATCTCTACCATCATCCGGTTCTCGAGAACCGGATGATGGTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-721s1c1
Sequence:CCGGACAGAATATGTATCGCCCTTACTCGAGTAAGGGCGATACATATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-859s1c1
Sequence:CCGGGTATCGCCGAAACTTCAATTACTCGAGTAATTGAAGTTTCGGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011732.1-896s1c1
Sequence:CCGGGAGAACCCTAAACCACAAGATCTCGAGATCTTGTGGTTTAGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011732
VALIDATED
YBX1 MISSION shRNA Lentiviral Transduction Particles
Y box binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000348052    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011732.2-1511s21c1
Sequence:CCGGCCTGTTAATAAAGGTCTTAAACTCGAGTTTAAGACCTTTATTAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222733    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-589s1c2
Sequence:CCGGGCGAAGGTTCCCACCTTACTACTCGAGTAGTAAGGTGGGAACCTTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011732.2-984s21c1
Sequence:CCGGGTATCGCCGAAACTTCAATTACTCGAGTAATTGAAGTTTCGGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333886    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011732.2-1021s21c1
Sequence:CCGGGAGAACCCTAAACCACAAGATCTCGAGATCTTGTGGTTTAGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334022    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011732.2-1132s21c1
Sequence:CCGGCATCTCTACCATCATCCGGTTCTCGAGAACCGGATGATGGTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077208    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011732.1-1007s1c1
Sequence:CCGGCATCTCTACCATCATCCGGTTCTCGAGAACCGGATGATGGTAGAGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-721s1c1
Sequence:CCGGACAGAATATGTATCGCCCTTACTCGAGTAAGGGCGATACATATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077211    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011732.1-859s1c1
Sequence:CCGGGTATCGCCGAAACTTCAATTACTCGAGTAATTGAAGTTTCGGCGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011732.1-896s1c1
Sequence:CCGGGAGAACCCTAAACCACAAGATCTCGAGATCTTGTGGTTTAGGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004559
VALIDATED
YBX1 MISSION shRNA Bacterial Glycerol Stock
Y box binding protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000315309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004559.3-588s21c1
Sequence:CCGGAGCAGACCGTAACCATTATAGCTCGAGCTATAATGGTTACGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004559.3-565s21c1
Sequence:CCGGCCAGTTCAAGGCAGTAAATATCTCGAGATATTTACTGCCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004559.2-1095s1c1
Sequence:CCGGGCTTACCATCTCTACCATCATCTCGAGATGATGGTAGAGATGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-885s1c1
Sequence:CCGGGACGGCAATGAAGAAGATAAACTCGAGTTTATCTTCTTCATTGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-308s1c1
Sequence:CCGGGTTCAATGTAAGGAACGGATACTCGAGTATCCGTTCCTTACATTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-507s1c1
Sequence:CCGGCCAGTTCAAGGCAGTAAATATCTCGAGATATTTACTGCCTTGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-537s1c1
Sequence:CCGGCGTAACCATTATAGACGCTATCTCGAGATAGCGTCTATAATGGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004559
VALIDATED
YBX1 MISSION shRNA shRNA Plasmid DNA
Y box binding protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000315309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004559.3-588s21c1
Sequence:CCGGAGCAGACCGTAACCATTATAGCTCGAGCTATAATGGTTACGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004559.3-565s21c1
Sequence:CCGGCCAGTTCAAGGCAGTAAATATCTCGAGATATTTACTGCCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004559.2-1095s1c1
Sequence:CCGGGCTTACCATCTCTACCATCATCTCGAGATGATGGTAGAGATGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-885s1c1
Sequence:CCGGGACGGCAATGAAGAAGATAAACTCGAGTTTATCTTCTTCATTGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-308s1c1
Sequence:CCGGGTTCAATGTAAGGAACGGATACTCGAGTATCCGTTCCTTACATTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-507s1c1
Sequence:CCGGCCAGTTCAAGGCAGTAAATATCTCGAGATATTTACTGCCTTGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-537s1c1
Sequence:CCGGCGTAACCATTATAGACGCTATCTCGAGATAGCGTCTATAATGGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004559
VALIDATED
YBX1 MISSION shRNA Lentiviral Transduction Particles
Y box binding protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000315309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_004559.3-588s21c1
Sequence:CCGGAGCAGACCGTAACCATTATAGCTCGAGCTATAATGGTTACGGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315307    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_004559.3-565s21c1
Sequence:CCGGCCAGTTCAAGGCAGTAAATATCTCGAGATATTTACTGCCTTGAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007948    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004559.2-1095s1c1
Sequence:CCGGGCTTACCATCTCTACCATCATCTCGAGATGATGGTAGAGATGGTAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007949    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-885s1c1
Sequence:CCGGGACGGCAATGAAGAAGATAAACTCGAGTTTATCTTCTTCATTGCCGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007951    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-308s1c1
Sequence:CCGGGTTCAATGTAAGGAACGGATACTCGAGTATCCGTTCCTTACATTGAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007952    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-507s1c1
Sequence:CCGGCCAGTTCAAGGCAGTAAATATCTCGAGATATTTACTGCCTTGAACTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007950    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004559.2-537s1c1
Sequence:CCGGCGTAACCATTATAGACGCTATCTCGAGATAGCGTCTATAATGGTTACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks