EMAIL THIS PAGE TO A FRIEND

YBX2

Y box binding protein 2

Synonyms: CONTRIN CSDA3 DBPC MSY2
UniProtKB ID: Q9Y2T7, D3DTP1, Q8N4P0
Gene ID:
Human(51087) Summary: This gene encodes a nucleic acid binding protein which is highly expressed in germ cells. The encoded protein binds to a Y-box element in the promoters of certain genes but also binds to mRNA transcribed from these genes. Pseudogenes for this gene are located on chromosome 10 and 15. [provided by RefSeq, Feb 2012]
Mouse(53422) Y box protein 2
Rat(303250) Y box binding protein 2
dog(489467) Y box binding protein 2
domestic cat(101096272) Y box binding protein 2
domestic guinea pig(100716346) Y box binding protein 2
naked mole-rat(101713877) Y box binding protein 2
cow(614429) Y box binding protein 2
sheep(101118116) Y box binding protein 2
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016875 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016875 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016875 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015982 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU060941 MISSION® esiRNA esiRNA targeting mouse Ybx2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015982 Rosetta Predictions human pricing
XM_001079683 Rosetta Predictions rat pricing
XM_220618 Rosetta Predictions rat pricing
NM_016875 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00054193 predicted 554
2 SASI_Hs01_00054194 predicted 791
3 SASI_Hs01_00054195 predicted 516
4 SASI_Hs01_00054196 predicted 512
5 SASI_Hs01_00054197 predicted 582
6 SASI_Hs01_00054198 predicted 516
7 SASI_Hs02_00348655 predicted 623
8 SASI_Hs01_00054199 predicted 583
9 SASI_Hs01_00054200 predicted 508
10 SASI_Hs01_00054201 predicted 772
11 SASI_Hs01_00054192 predicted 663
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079683 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00365101 predicted 551
2 SASI_Rn02_00365102 predicted 626
3 SASI_Rn02_00365103 predicted 488
4 SASI_Rn02_00365104 predicted 552
5 SASI_Rn02_00365105 predicted 370
6 SASI_Rn02_00365106 predicted 416
7 SASI_Rn02_00365107 predicted 415
8 SASI_Rn02_00365108 predicted 523
9 SASI_Rn02_00365109 predicted 742
10 SASI_Rn02_00365110 predicted 1033
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_220618 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00379446 predicted 569
2 SASI_Rn02_00379447 predicted 651
3 SASI_Rn02_00379448 predicted 506
4 SASI_Rn02_00379449 predicted 579
5 SASI_Rn02_00379450 predicted 392
6 SASI_Rn02_00379451 predicted 435
7 SASI_Rn02_00379452 predicted 435
8 SASI_Rn02_00379453 predicted 542
9 SASI_Rn02_00379454 predicted 765
10 SASI_Rn02_00379455 predicted 1056
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016875 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080109 predicted 609
2 SASI_Mm01_00080110 predicted 683
3 SASI_Mm01_00080112 predicted 418
4 SASI_Mm01_00080113 predicted 468
5 SASI_Mm01_00080114 predicted 578
6 SASI_Mm01_00080115 predicted 508
7 SASI_Mm01_00080116 predicted 862
8 SASI_Mm01_00080117 predicted 1086
9 SASI_Mm01_00080118 predicted 620
10 SASI_Mm02_00323680 predicted 474
11 SASI_Mm01_00080111 predicted 471
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016875
YBX2 MISSION shRNA Bacterial Glycerol Stock
Y box binding protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016875.1-1168s1c1
Sequence:CCGGCCCATAATTCATGACATCAAACTCGAGTTTGATGTCATGAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-957s1c1
Sequence:CCGGGCGTCCACGAAACCGTCCCTACTCGAGTAGGGACGGTTTCGTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-687s1c1
Sequence:CCGGCTTCTTCTATCGAAGGCGGTTCTCGAGAACCGCCTTCGATAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-315s1c1
Sequence:CCGGCCGGAATGGTTACGGATTCATCTCGAGATGAATCCGTAACCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-372s1c1
Sequence:CCGGCCAGACAGCTATTAAGAGAAACTCGAGTTTCTCTTAATAGCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016875
YBX2 MISSION shRNA shRNA Plasmid DNA
Y box binding protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016875.1-1168s1c1
Sequence:CCGGCCCATAATTCATGACATCAAACTCGAGTTTGATGTCATGAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-957s1c1
Sequence:CCGGGCGTCCACGAAACCGTCCCTACTCGAGTAGGGACGGTTTCGTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-687s1c1
Sequence:CCGGCTTCTTCTATCGAAGGCGGTTCTCGAGAACCGCCTTCGATAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-315s1c1
Sequence:CCGGCCGGAATGGTTACGGATTCATCTCGAGATGAATCCGTAACCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-372s1c1
Sequence:CCGGCCAGACAGCTATTAAGAGAAACTCGAGTTTCTCTTAATAGCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016875
YBX2 MISSION shRNA Lentiviral Transduction Particles
Y box binding protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095319    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016875.1-1168s1c1
Sequence:CCGGCCCATAATTCATGACATCAAACTCGAGTTTGATGTCATGAATTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-957s1c1
Sequence:CCGGGCGTCCACGAAACCGTCCCTACTCGAGTAGGGACGGTTTCGTGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-687s1c1
Sequence:CCGGCTTCTTCTATCGAAGGCGGTTCTCGAGAACCGCCTTCGATAGAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095320    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-315s1c1
Sequence:CCGGCCGGAATGGTTACGGATTCATCTCGAGATGAATCCGTAACCATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016875.1-372s1c1
Sequence:CCGGCCAGACAGCTATTAAGAGAAACTCGAGTTTCTCTTAATAGCTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015982
VALIDATED
YBX2 MISSION shRNA Bacterial Glycerol Stock
Y box binding protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000107505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-1183s1c1
Sequence:CCGGCCATCTGGTATCTGCCAGTTTCTCGAGAAACTGGCAGATACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-516s1c1
Sequence:CCGGGCGCAGAAGCCACTAATGTAACTCGAGTTACATTAGTGGCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-485s1c1
Sequence:CCGGGTGGAATTTGATGTCGTGGAACTCGAGTTCCACGACATCAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-889s1c1
Sequence:CCGGGCCCAGGTACCGAAGGCCTTTCTCGAGAAAGGCCTTCGGTACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000107506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-776s1c1
Sequence:CCGGCCCAACCAGCAGCAGCCTATACTCGAGTATAGGCTGCTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-487s21c1
Sequence:CCGGGTGGAATTTGATGTCGTGGAACTCGAGTTCCACGACATCAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-778s21c1
Sequence:CCGGCCCAACCAGCAGCAGCCTATACTCGAGTATAGGCTGCTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-518s21c1
Sequence:CCGGGCGCAGAAGCCACTAATGTAACTCGAGTTACATTAGTGGCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015982.3-1185s21c1
Sequence:CCGGCCATCTGGTATCTGCCAGTTTCTCGAGAAACTGGCAGATACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015982
VALIDATED
YBX2 MISSION shRNA shRNA Plasmid DNA
Y box binding protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000107505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-1183s1c1
Sequence:CCGGCCATCTGGTATCTGCCAGTTTCTCGAGAAACTGGCAGATACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-516s1c1
Sequence:CCGGGCGCAGAAGCCACTAATGTAACTCGAGTTACATTAGTGGCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-485s1c1
Sequence:CCGGGTGGAATTTGATGTCGTGGAACTCGAGTTCCACGACATCAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-889s1c1
Sequence:CCGGGCCCAGGTACCGAAGGCCTTTCTCGAGAAAGGCCTTCGGTACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000107506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-776s1c1
Sequence:CCGGCCCAACCAGCAGCAGCCTATACTCGAGTATAGGCTGCTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-487s21c1
Sequence:CCGGGTGGAATTTGATGTCGTGGAACTCGAGTTCCACGACATCAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-778s21c1
Sequence:CCGGCCCAACCAGCAGCAGCCTATACTCGAGTATAGGCTGCTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-518s21c1
Sequence:CCGGGCGCAGAAGCCACTAATGTAACTCGAGTTACATTAGTGGCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015982.3-1185s21c1
Sequence:CCGGCCATCTGGTATCTGCCAGTTTCTCGAGAAACTGGCAGATACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015982
VALIDATED
YBX2 MISSION shRNA Lentiviral Transduction Particles
Y box binding protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000107505    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-1183s1c1
Sequence:CCGGCCATCTGGTATCTGCCAGTTTCTCGAGAAACTGGCAGATACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107507    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-516s1c1
Sequence:CCGGGCGCAGAAGCCACTAATGTAACTCGAGTTACATTAGTGGCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-485s1c1
Sequence:CCGGGTGGAATTTGATGTCGTGGAACTCGAGTTCCACGACATCAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-889s1c1
Sequence:CCGGGCCCAGGTACCGAAGGCCTTTCTCGAGAAAGGCCTTCGGTACCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000107506    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_015982.1-776s1c1
Sequence:CCGGCCCAACCAGCAGCAGCCTATACTCGAGTATAGGCTGCTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-487s21c1
Sequence:CCGGGTGGAATTTGATGTCGTGGAACTCGAGTTCCACGACATCAAATTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-778s21c1
Sequence:CCGGCCCAACCAGCAGCAGCCTATACTCGAGTATAGGCTGCTGCTGGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331253    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015982.3-518s21c1
Sequence:CCGGGCGCAGAAGCCACTAATGTAACTCGAGTTACATTAGTGGCTTCTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300724    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015982.3-1185s21c1
Sequence:CCGGCCATCTGGTATCTGCCAGTTTCTCGAGAAACTGGCAGATACCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks