EMAIL THIS PAGE TO A FRIEND

YBX3

Y box binding protein 3

Synonyms: CSDA CSDA1 DBPA ZONAB
Species: Human YBX3(8531), Mouse Ybx3(56449), Rat Ybx3(83807), naked mole-rat Ybx3(101714720), domestic guinea pig Ybx3(100721154)
UniProtKB ID: P16989, B2RBW6, Q14121, Q969N6, Q96B76
Gene ID:
Mouse(56449) Y box protein 3
Rat(83807) Y box binding protein 3
naked mole-rat(101714720) Y box binding protein 3
domestic guinea pig(100721154) Y box binding protein 3
66 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003651 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003651 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003651 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011733 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011733 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011733 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003651 Rosetta Predictions human pricing
NM_031979 Rosetta Predictions rat pricing
NM_011733 Rosetta Predictions mouse pricing
NM_139117 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003651 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00336020 predicted 904
2 SASI_Hs01_00126816 predicted 1356
3 SASI_Hs02_00336021 predicted 1173
4 SASI_Hs01_00126818 predicted 701
5 SASI_Hs01_00126819 predicted 681
6 SASI_Hs02_00336022 predicted 711
7 SASI_Hs02_00336023 predicted 1174
8 SASI_Hs02_00336024 predicted 719
9 SASI_Hs02_00336025 predicted 1042
10 SASI_Hs01_00126820 predicted 646
11 SASI_Hs01_00126815 predicted 1371
12 SASI_Hs01_00126817 predicted 980
13 SASI_Hs01_00126821 predicted 1019
14 SASI_Hs01_00126822 predicted 643
15 SASI_Hs01_00126823 predicted 658
16 SASI_Hs01_00126824 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031979 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00080479 predicted 859
2 SASI_Rn01_00080480 predicted 1077
3 SASI_Rn01_00080481 predicted 1088
4 SASI_Rn01_00080482 predicted 675
5 SASI_Rn02_00265377 predicted 1203
6 SASI_Rn01_00080483 predicted 1050
7 SASI_Rn01_00080484 predicted 659
8 SASI_Rn01_00080485 predicted 853
9 SASI_Rn01_00080486 predicted 1293
10 SASI_Rn01_00080487 predicted 538
11 SASI_Rn01_00080488 predicted 989
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011733 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124389 predicted 1231
2 SASI_Mm01_00124390 predicted 1110
3 SASI_Mm01_00124391 predicted 1344
4 SASI_Mm01_00124392 predicted 1213
5 SASI_Mm01_00124393 predicted 1202
6 SASI_Mm01_00124394 predicted 1220
7 SASI_Mm01_00124395 predicted 1104
8 SASI_Mm01_00124396 predicted 1341
9 SASI_Mm01_00124397 predicted 1161
10 SASI_Mm01_00124398 predicted 1112
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139117 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190805 predicted 1441
2 SASI_Mm01_00190806 predicted 1320
3 SASI_Mm01_00190807 predicted 1544
4 SASI_Mm01_00190808 predicted 1423
5 SASI_Mm01_00190809 predicted 1411
6 SASI_Mm01_00190810 predicted 1428
7 SASI_Mm01_00190811 predicted 1312
8 SASI_Mm01_00190812 predicted 1553
9 SASI_Mm01_00190813 predicted 1364
10 SASI_Mm01_00190814 predicted 1315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003651
VALIDATED
YBX3 MISSION shRNA Bacterial Glycerol Stock
Y box binding protein 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1033s21c1
Sequence:CCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-579s21c1
Sequence:CCGGCGGAAATATCTGCGCAGTGTACTCGAGTACACTGCGCAGATATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1413s21c1
Sequence:CCGGCCAAAGAAACATCCAAGCAATCTCGAGATTGCTTGGATGTTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-494s21c1
Sequence:CCGGCAGAAATGGATATGGATTTATCTCGAGATAAATCCATATCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1161s21c1
Sequence:CCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1413s1c1
Sequence:CCGGCCAAAGAAACATCCAAGCAATCTCGAGATTGCTTGGATGTTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-579s1c1
Sequence:CCGGCGGAAATATCTGCGCAGTGTACTCGAGTACACTGCGCAGATATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1161s1c1
Sequence:CCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003651.3-563s1c1
Sequence:CCGGCAAGAAGAATAACCCACGGAACTCGAGTTCCGTGGGTTATTCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1033s1c1
Sequence:CCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003651
VALIDATED
YBX3 MISSION shRNA shRNA Plasmid DNA
Y box binding protein 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1033s21c1
Sequence:CCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-579s21c1
Sequence:CCGGCGGAAATATCTGCGCAGTGTACTCGAGTACACTGCGCAGATATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1413s21c1
Sequence:CCGGCCAAAGAAACATCCAAGCAATCTCGAGATTGCTTGGATGTTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-494s21c1
Sequence:CCGGCAGAAATGGATATGGATTTATCTCGAGATAAATCCATATCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1161s21c1
Sequence:CCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1413s1c1
Sequence:CCGGCCAAAGAAACATCCAAGCAATCTCGAGATTGCTTGGATGTTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-579s1c1
Sequence:CCGGCGGAAATATCTGCGCAGTGTACTCGAGTACACTGCGCAGATATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1161s1c1
Sequence:CCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003651.3-563s1c1
Sequence:CCGGCAAGAAGAATAACCCACGGAACTCGAGTTCCGTGGGTTATTCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1033s1c1
Sequence:CCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003651
VALIDATED
YBX3 MISSION shRNA Lentiviral Transduction Particles
Y box binding protein 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1033s21c1
Sequence:CCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-579s21c1
Sequence:CCGGCGGAAATATCTGCGCAGTGTACTCGAGTACACTGCGCAGATATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1413s21c1
Sequence:CCGGCCAAAGAAACATCCAAGCAATCTCGAGATTGCTTGGATGTTTCTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-494s21c1
Sequence:CCGGCAGAAATGGATATGGATTTATCTCGAGATAAATCCATATCCATTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_003651.3-1161s21c1
Sequence:CCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013228    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1413s1c1
Sequence:CCGGCCAAAGAAACATCCAAGCAATCTCGAGATTGCTTGGATGTTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-579s1c1
Sequence:CCGGCGGAAATATCTGCGCAGTGTACTCGAGTACACTGCGCAGATATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1161s1c1
Sequence:CCGGCCGTCTGTTCGCCGTGGATATCTCGAGATATCCACGGCGAACAGACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003651.3-563s1c1
Sequence:CCGGCAAGAAGAATAACCCACGGAACTCGAGTTCCGTGGGTTATTCTTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003651.3-1033s1c1
Sequence:CCGGCGGTTCATCGAAATCCAACTTCTCGAGAAGTTGGATTTCGATGAACCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011733
VALIDATED
YBX3 MISSION shRNA Bacterial Glycerol Stock
Y box binding protein 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000070433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-324s1c1
Sequence:CCGGGACACCAAAGAAGATGTGTTTCTCGAGAAACACATCTTCTTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-402s1c1
Sequence:CCGGGATGGAGAAACTGTAGAGTTTCTCGAGAAACTCTACAGTTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-284s1c1
Sequence:CCGGGTTCAACGTCAGAAATGGATACTCGAGTATCCATTTCTGACGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-471s1c1
Sequence:CCGGCCAGATGGAGTTCCTGTAGAACTCGAGTTCTACAGGAACTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000070434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-806s1c1
Sequence:CCGGCGCTGTTTCACAAGATGGCAACTCGAGTTGCCATCTTGTGAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011733
VALIDATED
YBX3 MISSION shRNA shRNA Plasmid DNA
Y box binding protein 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000070433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-324s1c1
Sequence:CCGGGACACCAAAGAAGATGTGTTTCTCGAGAAACACATCTTCTTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-402s1c1
Sequence:CCGGGATGGAGAAACTGTAGAGTTTCTCGAGAAACTCTACAGTTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-284s1c1
Sequence:CCGGGTTCAACGTCAGAAATGGATACTCGAGTATCCATTTCTGACGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-471s1c1
Sequence:CCGGCCAGATGGAGTTCCTGTAGAACTCGAGTTCTACAGGAACTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000070434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-806s1c1
Sequence:CCGGCGCTGTTTCACAAGATGGCAACTCGAGTTGCCATCTTGTGAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011733
VALIDATED
YBX3 MISSION shRNA Lentiviral Transduction Particles
Y box binding protein 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000070433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-324s1c1
Sequence:CCGGGACACCAAAGAAGATGTGTTTCTCGAGAAACACATCTTCTTTGGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070436    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-402s1c1
Sequence:CCGGGATGGAGAAACTGTAGAGTTTCTCGAGAAACTCTACAGTTTCTCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070437    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-284s1c1
Sequence:CCGGGTTCAACGTCAGAAATGGATACTCGAGTATCCATTTCTGACGTTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070435    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-471s1c1
Sequence:CCGGCCAGATGGAGTTCCTGTAGAACTCGAGTTCTACAGGAACTCCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000070434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_011733.1-806s1c1
Sequence:CCGGCGCTGTTTCACAAGATGGCAACTCGAGTTGCCATCTTGTGAAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks