EMAIL THIS PAGE TO A FRIEND

YDJC

YdjC homolog (bacterial)

UniProtKB ID: A8MPS7, Q2YDT4, Q4V9R7
Gene ID:
Mouse(69101) YdjC homolog (bacterial)
Rat(287938) YdjC homolog (bacterial)
Zebrafish(569036) YdjC homolog (bacterial)
chicken(771088) YdjC homolog (bacterial)
dog(100685573) YdjC homolog (bacterial)
domestic cat(101091313) YdjC homolog (bacterial)
domestic guinea pig(100714340) YdjC homolog (bacterial)
naked mole-rat(101703452) YdjC homolog (bacterial)
cow(538763) YdjC homolog (bacterial)
sheep(101120195) YdjC homolog (bacterial)
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026940 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026940 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026940 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001017964 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001017964 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001017964 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001017964 Rosetta Predictions human pricing
NM_001017965 Rosetta Predictions human pricing
NM_001013863 Rosetta Predictions rat pricing
NM_026940 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017964 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00243404 predicted 1106
2 SASI_Hs01_00243405 predicted 815
3 SASI_Hs02_00306831 predicted 289
4 SASI_Hs02_00306832 predicted 289
5 SASI_Hs02_00306833 predicted 1111
6 SASI_Hs01_00243412 predicted 663
7 SASI_Hs02_00306834 predicted 982
8 SASI_Hs02_00306835 predicted 645
9 SASI_Hs02_00306836 predicted 983
10 SASI_Hs02_00306837 predicted 663
11 SASI_Hs01_00243403 predicted 742
12 SASI_Hs01_00243406 predicted 1091
13 SASI_Hs01_00243407 predicted 742
14 SASI_Hs01_00243408 predicted 735
15 SASI_Hs01_00243409 predicted 649
16 SASI_Hs01_00243410 predicted 708
17 SASI_Hs01_00243411 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173696 predicted 802
2 SASI_Hs01_00173697 predicted 882
3 SASI_Hs01_00173698 predicted 803
4 SASI_Hs01_00173699 predicted 798
5 SASI_Hs01_00173700 predicted 709
6 SASI_Hs01_00173701 predicted 768
7 SASI_Hs01_00173702 predicted 738
8 SASI_Hs01_00173703 predicted 723
9 SASI_Hs01_00173704 predicted 909
10 SASI_Hs01_00173705 predicted 107
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013863 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081305 predicted 802
2 SASI_Rn01_00081306 predicted 1152
3 SASI_Rn01_00081308 predicted 947
4 SASI_Rn01_00081309 predicted 1167
5 SASI_Rn01_00081310 predicted 937
6 SASI_Rn01_00081311 predicted 788
7 SASI_Rn01_00081312 predicted 1133
8 SASI_Rn01_00081313 predicted 458
9 SASI_Rn02_00201130 predicted 1083
10 SASI_Rn01_00081314 predicted 1142
11 SASI_Rn01_00081307 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026940 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064174 predicted 780
2 SASI_Mm01_00064175 predicted 978
3 SASI_Mm01_00064176 predicted 824
4 SASI_Mm01_00064177 predicted 1053
5 SASI_Mm01_00064178 predicted 625
6 SASI_Mm01_00064179 predicted 643
7 SASI_Mm01_00064180 predicted 1016
8 SASI_Mm01_00064181 predicted 725
9 SASI_Mm01_00064182 predicted 1019
10 SASI_Mm01_00064183 predicted 867
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026940
YDJC MISSION shRNA Bacterial Glycerol Stock
YdjC homolog (bacterial)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000184040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-786s1c1
Sequence:CCGGCCAGATGCGTTCTCTTGTTCTCTCGAGAGAACAAGAGAACGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-37s1c1
Sequence:CCGGCCGCTGATGACTTTGGTTATTCTCGAGAATAACCAAAGTCATCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-890s1c1
Sequence:CCGGCATTGATGACCTGGATTCCAACTCGAGTTGGAATCCAGGTCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-787s1c1
Sequence:CCGGCAGATGCGTTCTCTTGTTCTTCTCGAGAAGAACAAGAGAACGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-889s1c1
Sequence:CCGGCCATTGATGACCTGGATTCCACTCGAGTGGAATCCAGGTCATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026940
YDJC MISSION shRNA shRNA Plasmid DNA
YdjC homolog (bacterial)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000184040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-786s1c1
Sequence:CCGGCCAGATGCGTTCTCTTGTTCTCTCGAGAGAACAAGAGAACGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-37s1c1
Sequence:CCGGCCGCTGATGACTTTGGTTATTCTCGAGAATAACCAAAGTCATCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-890s1c1
Sequence:CCGGCATTGATGACCTGGATTCCAACTCGAGTTGGAATCCAGGTCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-787s1c1
Sequence:CCGGCAGATGCGTTCTCTTGTTCTTCTCGAGAAGAACAAGAGAACGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-889s1c1
Sequence:CCGGCCATTGATGACCTGGATTCCACTCGAGTGGAATCCAGGTCATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026940
YDJC MISSION shRNA Lentiviral Transduction Particles
YdjC homolog (bacterial)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000184040    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-786s1c1
Sequence:CCGGCCAGATGCGTTCTCTTGTTCTCTCGAGAGAACAAGAGAACGCATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180109    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-37s1c1
Sequence:CCGGCCGCTGATGACTTTGGTTATTCTCGAGAATAACCAAAGTCATCAGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180138    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-890s1c1
Sequence:CCGGCATTGATGACCTGGATTCCAACTCGAGTTGGAATCCAGGTCATCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-787s1c1
Sequence:CCGGCAGATGCGTTCTCTTGTTCTTCTCGAGAAGAACAAGAGAACGCATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184399    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026940.1-889s1c1
Sequence:CCGGCCATTGATGACCTGGATTCCACTCGAGTGGAATCCAGGTCATCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001017964
YDJC MISSION shRNA Bacterial Glycerol Stock
YdjC homolog (bacterial)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000245365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017964.1-1149s21c1
Sequence:CCGGAGGTCCTCATGCCTCCAAATGCTCGAGCATTTGGAGGCATGAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-819s21c1
Sequence:CCGGCCGACGCTTTCTCTTGCTCTTCTCGAGAAGAGCAAGAGAAAGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-105s21c1
Sequence:CCGGAGGGTATCGTGGAGGCCTTTCCTCGAGGAAAGGCCTCCACGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-343s21c1
Sequence:CCGGAGACGTGGATTTGCCTCAGGTCTCGAGACCTGAGGCAAATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-302s21c1
Sequence:CCGGTTCCTTGGCAAGATGGGATTCCTCGAGGAATCCCATCTTGCCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001017964
YDJC MISSION shRNA shRNA Plasmid DNA
YdjC homolog (bacterial)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000245365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017964.1-1149s21c1
Sequence:CCGGAGGTCCTCATGCCTCCAAATGCTCGAGCATTTGGAGGCATGAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-819s21c1
Sequence:CCGGCCGACGCTTTCTCTTGCTCTTCTCGAGAAGAGCAAGAGAAAGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-105s21c1
Sequence:CCGGAGGGTATCGTGGAGGCCTTTCCTCGAGGAAAGGCCTCCACGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-343s21c1
Sequence:CCGGAGACGTGGATTTGCCTCAGGTCTCGAGACCTGAGGCAAATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-302s21c1
Sequence:CCGGTTCCTTGGCAAGATGGGATTCCTCGAGGAATCCCATCTTGCCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001017964
YDJC MISSION shRNA Lentiviral Transduction Particles
YdjC homolog (bacterial)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000245365    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001017964.1-1149s21c1
Sequence:CCGGAGGTCCTCATGCCTCCAAATGCTCGAGCATTTGGAGGCATGAGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-819s21c1
Sequence:CCGGCCGACGCTTTCTCTTGCTCTTCTCGAGAAGAGCAAGAGAAAGCGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241565    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-105s21c1
Sequence:CCGGAGGGTATCGTGGAGGCCTTTCCTCGAGGAAAGGCCTCCACGATACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-343s21c1
Sequence:CCGGAGACGTGGATTTGCCTCAGGTCTCGAGACCTGAGGCAAATCCACGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001017964.1-302s21c1
Sequence:CCGGTTCCTTGGCAAGATGGGATTCCTCGAGGAATCCCATCTTGCCAAGGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks