EMAIL THIS PAGE TO A FRIEND

YEATS2

YEATS domain containing 2

UniProtKB ID: Q9ULM3, A7E2B9, D3DNS9, Q641P6, Q9NW96
Gene ID:
Human(55689) Summary: YEATS2 is a scaffolding subunit of the ADA2A (TADA2A; MIM 602276)-containing (ATAC) histone acetyltransferase complex (Wang et al., 2008 [PubMed 18838386]
Mouse(208146) YEATS domain containing 2
Rat(498112) YEATS domain containing 2
chicken(424764) YEATS domain containing 2
dog(488099) YEATS domain containing 2
domestic cat(101091304) YEATS domain containing 2
cow(514192) YEATS domain containing 2
sheep(101109507) YEATS domain containing 2
naked mole-rat(101720457) YEATS domain containing 2
Domestic Rabbit(100351769) YEATS domain containing 2
domestic guinea pig(100728273) YEATS domain containing 2
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018023 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018023 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018023 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033237 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033237 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033237 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018023 Rosetta Predictions human pricing
NM_001109057 Rosetta Predictions rat pricing
NM_001033237 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018023 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00177010 predicted 734
2 SASI_Hs01_00177011 predicted 826
3 SASI_Hs02_00351123 predicted 3133
4 SASI_Hs01_00177012 predicted 4002
5 SASI_Hs01_00177013 predicted 871
6 SASI_Hs01_00177014 predicted 1732
7 SASI_Hs01_00177016 predicted 534
8 SASI_Hs01_00177017 predicted 1883
9 SASI_Hs01_00177018 predicted 372
10 SASI_Hs02_00351124 predicted 618
11 SASI_Hs01_00177015 predicted 915
12 SASI_Hs01_00177019 predicted 795
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109057 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244700 predicted 700
2 SASI_Rn02_00244701 predicted 3423
3 SASI_Rn02_00244702 predicted 440
4 SASI_Rn02_00244703 predicted 1706
5 SASI_Rn02_00244704 predicted 2238
6 SASI_Rn02_00244705 predicted 2146
7 SASI_Rn02_00244706 predicted 3463
8 SASI_Rn02_00244707 predicted 3181
9 SASI_Rn02_00244708 predicted 3408
10 SASI_Rn02_00244709 predicted 3839
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033237 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00288364 predicted 324
2 SASI_Mm02_00288365 predicted 713
3 SASI_Mm02_00288366 predicted 3144
4 SASI_Mm02_00288367 predicted 2240
5 SASI_Mm02_00288368 predicted 3386
6 SASI_Mm02_00288369 predicted 3383
7 SASI_Mm02_00288370 predicted 749
8 SASI_Mm02_00288371 predicted 444
9 SASI_Mm02_00288372 predicted 2513
10 SASI_Mm02_00288373 predicted 3248
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018023
VALIDATED
YEATS2 MISSION shRNA Bacterial Glycerol Stock
YEATS domain containing 2
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018023.4-4706s21c1
Sequence:CCGGCCAGCGTTTCTGCAGTCTTTGCTCGAGCAAAGACTGCAGAAACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018023.4-4618s21c1
Sequence:CCGGACGCTGCACTCCAGATGAAATCTCGAGATTTCATCTGGAGTGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-383s21c1
Sequence:CCGGTCATTGACCAGCGACTGATTGCTCGAGCAATCAGTCGCTGGTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-2450s21c1
Sequence:CCGGATTTGCCTCCTGGCACTAAACCTCGAGGTTTAGTGCCAGGAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-1741s21c1
Sequence:CCGGAGTACAGGAAGTCCTACAAACCTCGAGGTTTGTAGGACTTCCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-659s21c1
Sequence:CCGGATAACAGCAATATGGATATAGCTCGAGCTATATCCATATTGCTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018023.3-1053s1c1
Sequence:CCGGCGTCAGAGTTCAAGTTCATTTCTCGAGAAATGAACTTGAACTCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-2475s1c1
Sequence:CCGGCCTAACTACAAACAGCAAGAACTCGAGTTCTTGCTGTTTGTAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018023.3-5658s1c1
Sequence:CCGGCCAGTCAGAAATCTGTTCTATCTCGAGATAGAACAGATTTCTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-1568s1c1
Sequence:CCGGGCTGCAAGATTGTGTCAGGTTCTCGAGAACCTGACACAATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-2544s1c1
Sequence:CCGGGCGAGCTACGAACAATGCTAACTCGAGTTAGCATTGTTCGTAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-716s1c1
Sequence:CCGGGCCGAAATACTGGAAGGGATACTCGAGTATCCCTTCCAGTATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-2265s1c1
Sequence:CCGGGCAAGTTGTAACCCAAGGAGTCTCGAGACTCCTTGGGTTACAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-4095s1c1
Sequence:CCGGCGAGCCAGTGAAGATAAACATCTCGAGATGTTTATCTTCACTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018023
VALIDATED
YEATS2 MISSION shRNA shRNA Plasmid DNA
YEATS domain containing 2
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018023.4-4706s21c1
Sequence:CCGGCCAGCGTTTCTGCAGTCTTTGCTCGAGCAAAGACTGCAGAAACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018023.4-4618s21c1
Sequence:CCGGACGCTGCACTCCAGATGAAATCTCGAGATTTCATCTGGAGTGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-383s21c1
Sequence:CCGGTCATTGACCAGCGACTGATTGCTCGAGCAATCAGTCGCTGGTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-2450s21c1
Sequence:CCGGATTTGCCTCCTGGCACTAAACCTCGAGGTTTAGTGCCAGGAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-1741s21c1
Sequence:CCGGAGTACAGGAAGTCCTACAAACCTCGAGGTTTGTAGGACTTCCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-659s21c1
Sequence:CCGGATAACAGCAATATGGATATAGCTCGAGCTATATCCATATTGCTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018023.3-1053s1c1
Sequence:CCGGCGTCAGAGTTCAAGTTCATTTCTCGAGAAATGAACTTGAACTCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-2475s1c1
Sequence:CCGGCCTAACTACAAACAGCAAGAACTCGAGTTCTTGCTGTTTGTAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018023.3-5658s1c1
Sequence:CCGGCCAGTCAGAAATCTGTTCTATCTCGAGATAGAACAGATTTCTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-1568s1c1
Sequence:CCGGGCTGCAAGATTGTGTCAGGTTCTCGAGAACCTGACACAATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-2544s1c1
Sequence:CCGGGCGAGCTACGAACAATGCTAACTCGAGTTAGCATTGTTCGTAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-716s1c1
Sequence:CCGGGCCGAAATACTGGAAGGGATACTCGAGTATCCCTTCCAGTATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-2265s1c1
Sequence:CCGGGCAAGTTGTAACCCAAGGAGTCTCGAGACTCCTTGGGTTACAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-4095s1c1
Sequence:CCGGCGAGCCAGTGAAGATAAACATCTCGAGATGTTTATCTTCACTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018023
VALIDATED
YEATS2 MISSION shRNA Lentiviral Transduction Particles
YEATS domain containing 2
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436759    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018023.4-4706s21c1
Sequence:CCGGCCAGCGTTTCTGCAGTCTTTGCTCGAGCAAAGACTGCAGAAACGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419328    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018023.4-4618s21c1
Sequence:CCGGACGCTGCACTCCAGATGAAATCTCGAGATTTCATCTGGAGTGCAGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417949    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-383s21c1
Sequence:CCGGTCATTGACCAGCGACTGATTGCTCGAGCAATCAGTCGCTGGTCAATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-2450s21c1
Sequence:CCGGATTTGCCTCCTGGCACTAAACCTCGAGGTTTAGTGCCAGGAGGCAAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432505    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-1741s21c1
Sequence:CCGGAGTACAGGAAGTCCTACAAACCTCGAGGTTTGTAGGACTTCCTGTACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431997    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018023.4-659s21c1
Sequence:CCGGATAACAGCAATATGGATATAGCTCGAGCTATATCCATATTGCTGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144252    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_018023.3-1053s1c1
Sequence:CCGGCGTCAGAGTTCAAGTTCATTTCTCGAGAAATGAACTTGAACTCTGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144134    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-2475s1c1
Sequence:CCGGCCTAACTACAAACAGCAAGAACTCGAGTTCTTGCTGTTTGTAGTTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144016    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018023.3-5658s1c1
Sequence:CCGGCCAGTCAGAAATCTGTTCTATCTCGAGATAGAACAGATTTCTGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-1568s1c1
Sequence:CCGGGCTGCAAGATTGTGTCAGGTTCTCGAGAACCTGACACAATCTTGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140296    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-2544s1c1
Sequence:CCGGGCGAGCTACGAACAATGCTAACTCGAGTTAGCATTGTTCGTAGCTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140368    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-716s1c1
Sequence:CCGGGCCGAAATACTGGAAGGGATACTCGAGTATCCCTTCCAGTATTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140478    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018023.3-2265s1c1
Sequence:CCGGGCAAGTTGTAACCCAAGGAGTCTCGAGACTCCTTGGGTTACAACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018023.3-4095s1c1
Sequence:CCGGCGAGCCAGTGAAGATAAACATCTCGAGATGTTTATCTTCACTGGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033237
VALIDATED
YEATS2 MISSION shRNA Bacterial Glycerol Stock
YEATS domain containing 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-800s21c1
Sequence:GTACCGGTTCCTTCATCCTAGCTATAAACTCGAGTTTATAGCTAGGATGAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-924s21c1
Sequence:GTACCGGACAAGCGGATAGATATCATACCTCGAGGTATGATATCTATCCGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-2242s21c1
Sequence:CCGGGCAACTACCAGCCACTAATTTCTCGAGAAATTAGTGGCTGGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-5211s21c1
Sequence:CCGGCCCAGTCCTCCTGACTATTATCTCGAGATAATAGTCAGGAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-3390s21c1
Sequence:CCGGAGCTAAGCAACTACGTCATTACTCGAGTAATGACGTAGTTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033237
VALIDATED
YEATS2 MISSION shRNA shRNA Plasmid DNA
YEATS domain containing 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-800s21c1
Sequence:GTACCGGTTCCTTCATCCTAGCTATAAACTCGAGTTTATAGCTAGGATGAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-924s21c1
Sequence:GTACCGGACAAGCGGATAGATATCATACCTCGAGGTATGATATCTATCCGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-2242s21c1
Sequence:CCGGGCAACTACCAGCCACTAATTTCTCGAGAAATTAGTGGCTGGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-5211s21c1
Sequence:CCGGCCCAGTCCTCCTGACTATTATCTCGAGATAATAGTCAGGAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-3390s21c1
Sequence:CCGGAGCTAAGCAACTACGTCATTACTCGAGTAATGACGTAGTTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033237
VALIDATED
YEATS2 MISSION shRNA Lentiviral Transduction Particles
YEATS domain containing 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-800s21c1
Sequence:GTACCGGTTCCTTCATCCTAGCTATAAACTCGAGTTTATAGCTAGGATGAAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219117    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-924s21c1
Sequence:GTACCGGACAAGCGGATAGATATCATACCTCGAGGTATGATATCTATCCGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234215    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-2242s21c1
Sequence:CCGGGCAACTACCAGCCACTAATTTCTCGAGAAATTAGTGGCTGGTAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234217    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-5211s21c1
Sequence:CCGGCCCAGTCCTCCTGACTATTATCTCGAGATAATAGTCAGGAGGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234216    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001033237.1-3390s21c1
Sequence:CCGGAGCTAAGCAACTACGTCATTACTCGAGTAATGACGTAGTTGCTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks