EMAIL THIS PAGE TO A FRIEND

YEATS4

YEATS domain containing 4

Synonyms: 4930573H17Rik B230215M10Rik GAS41 NUBI-1 YAF9
UniProtKB ID: O95619, Q9NQD0
Gene ID:
Human(8089) Summary: The protein encoded by this gene is found in the nucleoli. It has high sequence homology to human MLLT1, and yeast and human MLLT3 proteins. Both MLLT1 and MLLT3 proteins belong to a class of transcription factors, indicating that the encoded protein might also represent a transcription factor. This protein is thought to be required for RNA transcription. This gene has been shown to be amplified in tumors. [provided by RefSeq, Jul 2008]
Mouse(64050) YEATS domain containing 4
Rat(299810) YEATS domain containing 4
Zebrafish(437025) YEATS domain containing 4
chicken(771226) YEATS domain containing 4
dog(474443) YEATS domain containing 4
domestic cat(101098643) YEATS domain containing 4
domestic guinea pig(100728359) YEATS domain containing 4
naked mole-rat(101696959) YEATS domain containing 4
cow(615330) YEATS domain containing 4
sheep(100302361) YEATS domain containing 4
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006530 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006530 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006530 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026570 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026570 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026570 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006530 Rosetta Predictions human pricing
NM_001127527 Rosetta Predictions rat pricing
NM_026570 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027666 predicted 656
2 SASI_Hs02_00341771 predicted 915
3 SASI_Hs01_00027667 predicted 441
4 SASI_Hs01_00027668 predicted 695
5 SASI_Hs02_00341772 predicted 344
6 SASI_Hs01_00027669 predicted 391
7 SASI_Hs01_00027670 predicted 469
8 SASI_Hs01_00027672 predicted 544
9 SASI_Hs01_00027674 predicted 959
10 SASI_Hs01_00027675 predicted 258
11 SASI_Hs01_00027671 predicted 369
12 SASI_Hs01_00027673 predicted 551
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127527 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254023 predicted 503
2 SASI_Rn02_00254024 predicted 493
3 SASI_Rn02_00254025 predicted 475
4 SASI_Rn02_00254026 predicted 463
5 SASI_Rn02_00254027 predicted 603
6 SASI_Rn02_00254028 predicted 274
7 SASI_Rn02_00254029 predicted 632
8 SASI_Rn02_00254030 predicted 251
9 SASI_Rn02_00254031 predicted 269
10 SASI_Rn02_00254032 predicted 590
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026570 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091635 predicted 349
2 SASI_Mm01_00091636 predicted 439
3 SASI_Mm01_00091637 predicted 356
4 SASI_Mm01_00091638 predicted 769
5 SASI_Mm01_00091639 predicted 644
6 SASI_Mm01_00091640 predicted 413
7 SASI_Mm01_00091641 predicted 215
8 SASI_Mm01_00091642 predicted 327
9 SASI_Mm02_00330517 predicted 572
10 SASI_Mm01_00091643 predicted 732
11 SASI_Mm01_00091644 predicted 756
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006530
VALIDATED
YEATS4 MISSION shRNA Bacterial Glycerol Stock
YEATS domain containing 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000013143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006530.2-1085s1c1
Sequence:CCGGGTGTGTAAGAATGGATGCTATCTCGAGATAGCATCCATTCTTACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-445s1c1
Sequence:CCGGGCAATCCTTTAAGAGTTGTTACTCGAGTAACAACTCTTAAAGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-578s1c1
Sequence:CCGGGCTGTTTCAATCAGACACCAACTCGAGTTGGTGTCTGATTGAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-701s1c1
Sequence:CCGGGCTAACATTAGGAGCCTATAACTCGAGTTATAGGCTCCTAATGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000013147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006530.2-291s1c1
Sequence:CCGGCCAATAGTTTACGGTAATGTTCTCGAGAACATTACCGTAAACTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-1088s21c1
Sequence:CCGGTGTAAGAATGGATGCTATATACTCGAGTATATAGCATCCATTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-690s21c1
Sequence:CCGGACATCTCGTCAGCTAACATTACTCGAGTAATGTTAGCTGACGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-663s21c1
Sequence:CCGGACAGCAATGATGCAACAATTACTCGAGTAATTGTTGCATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-302s21c1
Sequence:CCGGCGGTAATGTTGCTCGGTATTTCTCGAGAAATACCGAGCAACATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-271s21c1
Sequence:CCGGAGGGTGTTACTATCGTTAAACCTCGAGGTTTAACGATAGTAACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006530
VALIDATED
YEATS4 MISSION shRNA shRNA Plasmid DNA
YEATS domain containing 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000013143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006530.2-1085s1c1
Sequence:CCGGGTGTGTAAGAATGGATGCTATCTCGAGATAGCATCCATTCTTACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-445s1c1
Sequence:CCGGGCAATCCTTTAAGAGTTGTTACTCGAGTAACAACTCTTAAAGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-578s1c1
Sequence:CCGGGCTGTTTCAATCAGACACCAACTCGAGTTGGTGTCTGATTGAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-701s1c1
Sequence:CCGGGCTAACATTAGGAGCCTATAACTCGAGTTATAGGCTCCTAATGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000013147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006530.2-291s1c1
Sequence:CCGGCCAATAGTTTACGGTAATGTTCTCGAGAACATTACCGTAAACTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-1088s21c1
Sequence:CCGGTGTAAGAATGGATGCTATATACTCGAGTATATAGCATCCATTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-690s21c1
Sequence:CCGGACATCTCGTCAGCTAACATTACTCGAGTAATGTTAGCTGACGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-663s21c1
Sequence:CCGGACAGCAATGATGCAACAATTACTCGAGTAATTGTTGCATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-302s21c1
Sequence:CCGGCGGTAATGTTGCTCGGTATTTCTCGAGAAATACCGAGCAACATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-271s21c1
Sequence:CCGGAGGGTGTTACTATCGTTAAACCTCGAGGTTTAACGATAGTAACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006530
VALIDATED
YEATS4 MISSION shRNA Lentiviral Transduction Particles
YEATS domain containing 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000013143    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006530.2-1085s1c1
Sequence:CCGGGTGTGTAAGAATGGATGCTATCTCGAGATAGCATCCATTCTTACACACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-445s1c1
Sequence:CCGGGCAATCCTTTAAGAGTTGTTACTCGAGTAACAACTCTTAAAGGATTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013145    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-578s1c1
Sequence:CCGGGCTGTTTCAATCAGACACCAACTCGAGTTGGTGTCTGATTGAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013146    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006530.2-701s1c1
Sequence:CCGGGCTAACATTAGGAGCCTATAACTCGAGTTATAGGCTCCTAATGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000013147    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006530.2-291s1c1
Sequence:CCGGCCAATAGTTTACGGTAATGTTCTCGAGAACATTACCGTAAACTATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232185    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-1088s21c1
Sequence:CCGGTGTAAGAATGGATGCTATATACTCGAGTATATAGCATCCATTCTTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-690s21c1
Sequence:CCGGACATCTCGTCAGCTAACATTACTCGAGTAATGTTAGCTGACGAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232183    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-663s21c1
Sequence:CCGGACAGCAATGATGCAACAATTACTCGAGTAATTGTTGCATCATTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232182    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-302s21c1
Sequence:CCGGCGGTAATGTTGCTCGGTATTTCTCGAGAAATACCGAGCAACATTACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232181    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006530.2-271s21c1
Sequence:CCGGAGGGTGTTACTATCGTTAAACCTCGAGGTTTAACGATAGTAACACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026570
VALIDATED
YEATS4 MISSION shRNA Bacterial Glycerol Stock
YEATS domain containing 4
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-323s1c1
Sequence:CCGGCCTACAGAAACGAGGATATGTCTCGAGACATATCCTCGTTTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-574s1c1
Sequence:CCGGGAGTTCTATGACGAAATGATACTCGAGTATCATTTCGTCATAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026570.1-235s1c1
Sequence:CCGGCCAATCGTTTATGGCAATGTTCTCGAGAACATTGCCATAAACGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-645s1c1
Sequence:CCGGGCTGACATTGGGAGCCTATAACTCGAGTTATAGGCTCCCAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026570.4-804s21c1
Sequence:CCGGAGCAAGTCGTGAAACTATAAACTCGAGTTTATAGTTTCACGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-1072s21c1
Sequence:CCGGGTAGCATTCCACGACGTTAAGCTCGAGCTTAACGTCGTGGAATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026570.4-354s21c1
Sequence:CCGGGCCCTACAGAAACGAGGATATCTCGAGATATCCTCGTTTCTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-259s21c1
Sequence:CCGGATCGTTAAGCCAATCGTTTATCTCGAGATAAACGATTGGCTTAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.3-1037s21c1
Sequence:CCGGGGTAGCATTCCACGACGTTAACTCGAGTTAACGTCGTGGAATGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.3-644s21c1
Sequence:CCGGGCTGACATTGGGAGCCTATAACTCGAGTTATAGGCTCCCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-281s21c1
Sequence:CCGGGCAATGTTGCCAGGTACTTTGCTCGAGCAAAGTACCTGGCAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026570
VALIDATED
YEATS4 MISSION shRNA shRNA Plasmid DNA
YEATS domain containing 4
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-323s1c1
Sequence:CCGGCCTACAGAAACGAGGATATGTCTCGAGACATATCCTCGTTTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-574s1c1
Sequence:CCGGGAGTTCTATGACGAAATGATACTCGAGTATCATTTCGTCATAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026570.1-235s1c1
Sequence:CCGGCCAATCGTTTATGGCAATGTTCTCGAGAACATTGCCATAAACGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-645s1c1
Sequence:CCGGGCTGACATTGGGAGCCTATAACTCGAGTTATAGGCTCCCAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026570.4-804s21c1
Sequence:CCGGAGCAAGTCGTGAAACTATAAACTCGAGTTTATAGTTTCACGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-1072s21c1
Sequence:CCGGGTAGCATTCCACGACGTTAAGCTCGAGCTTAACGTCGTGGAATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026570.4-354s21c1
Sequence:CCGGGCCCTACAGAAACGAGGATATCTCGAGATATCCTCGTTTCTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-259s21c1
Sequence:CCGGATCGTTAAGCCAATCGTTTATCTCGAGATAAACGATTGGCTTAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.3-1037s21c1
Sequence:CCGGGGTAGCATTCCACGACGTTAACTCGAGTTAACGTCGTGGAATGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.3-644s21c1
Sequence:CCGGGCTGACATTGGGAGCCTATAACTCGAGTTATAGGCTCCCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-281s21c1
Sequence:CCGGGCAATGTTGCCAGGTACTTTGCTCGAGCAAAGTACCTGGCAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026570
VALIDATED
YEATS4 MISSION shRNA Lentiviral Transduction Particles
YEATS domain containing 4
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193708    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-323s1c1
Sequence:CCGGCCTACAGAAACGAGGATATGTCTCGAGACATATCCTCGTTTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-574s1c1
Sequence:CCGGGAGTTCTATGACGAAATGATACTCGAGTATCATTTCGTCATAGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174371    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026570.1-235s1c1
Sequence:CCGGCCAATCGTTTATGGCAATGTTCTCGAGAACATTGCCATAAACGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173348    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026570.1-645s1c1
Sequence:CCGGGCTGACATTGGGAGCCTATAACTCGAGTTATAGGCTCCCAATGTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026570.4-804s21c1
Sequence:CCGGAGCAAGTCGTGAAACTATAAACTCGAGTTTATAGTTTCACGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328724    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-1072s21c1
Sequence:CCGGGTAGCATTCCACGACGTTAAGCTCGAGCTTAACGTCGTGGAATGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328725    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026570.4-354s21c1
Sequence:CCGGGCCCTACAGAAACGAGGATATCTCGAGATATCCTCGTTTCTGTAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-259s21c1
Sequence:CCGGATCGTTAAGCCAATCGTTTATCTCGAGATAAACGATTGGCTTAACGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297105    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.3-1037s21c1
Sequence:CCGGGGTAGCATTCCACGACGTTAACTCGAGTTAACGTCGTGGAATGCTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.3-644s21c1
Sequence:CCGGGCTGACATTGGGAGCCTATAACTCGAGTTATAGGCTCCCAATGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026570.4-281s21c1
Sequence:CCGGGCAATGTTGCCAGGTACTTTGCTCGAGCAAAGTACCTGGCAACATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks