EMAIL THIS PAGE TO A FRIEND

YES1

v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1

Synonyms: HsT441 P61-YES Yes c-yes
UniProtKB ID: P07947, A6NLB3, D3DUH1
Gene ID:
Human(7525) Summary: This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
Mouse(22612) Yamaguchi sarcoma viral (v-yes) oncogene homolog 1
Rat(24884) Yamaguchi sarcoma viral (v-yes) oncogene homolog 1
Zebrafish(407620) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Horse(100061075) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
chicken(396238) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
dog(490532) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
dog(403917) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
domestic cat(101090724) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
cow(507632) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
sheep(101104362) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
naked mole-rat(101721967) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Domestic Rabbit(100346628) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
domestic guinea pig(100721080) v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
192 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302519 ANTI-MOUSE YES1 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
Y0521 Anti-YES1 (356-369) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
Y0646 Anti-YES1 (6-18) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406604 Anti-YES1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1412081 ANTI-YES1 antibody produced in mouse clone 3C6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1412621 ANTI-YES1 antibody produced in mouse clone 2A12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
HPA026480 Anti-YES1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
WH0007525M1 Monoclonal Anti-YES1 antibody produced in mouse clone 2F4, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1404532 Monoclonal Anti-YES1 antibody produced in mouse clone 2D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB5300357 Monoclonal Anti-YES1 antibody produced in mouse clone 2F3E6, ascites fluid human
ELISA, western blot pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0425 AQUA Peptide GSLLDFL[K] human, mouse, rat pricing
AQ0427 AQUA Peptide LIEDNEYTA[R] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009535 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009535 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009535 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005433 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005433 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005433 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU103601 MISSION® esiRNA esiRNA human LOH12CR2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005433 siRNAs that have been validated in the lab human pricing
NM_033298 Rosetta Predictions rat pricing
NM_009535 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005433 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086922 validated 384
1 SASI_Hs01_00086921 validated 1707
1 SASI_Hs01_00086920 validated 602
2 SASI_Hs01_00086923 predicted 1550
3 SASI_Hs01_00086924 predicted 668
4 SASI_Hs01_00086925 predicted 1641
5 SASI_Hs02_00339584 predicted 460
6 SASI_Hs01_00086926 predicted 251
7 SASI_Hs01_00086927 predicted 953
8 SASI_Hs01_00086928 predicted 952
9 SASI_Hs01_00086929 predicted 1164
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033298 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265523 predicted 747
2 SASI_Rn02_00265524 predicted 631
3 SASI_Rn02_00265525 predicted 804
4 SASI_Rn02_00265526 predicted 555
5 SASI_Rn02_00265527 predicted 787
6 SASI_Rn02_00265528 predicted 254
7 SASI_Rn02_00265529 predicted 1545
8 SASI_Rn02_00265530 predicted 930
9 SASI_Rn02_00265531 predicted 526
10 SASI_Rn02_00265532 predicted 604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009535 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00179951 predicted 1338
2 SASI_Mm02_00316363 predicted 1016
3 SASI_Mm01_00179952 predicted 1020
4 SASI_Mm01_00179953 predicted 744
5 SASI_Mm01_00179954 predicted 951
6 SASI_Mm01_00179955 predicted 915
7 SASI_Mm01_00179956 predicted 2020
8 SASI_Mm01_00179957 predicted 1760
9 SASI_Mm01_00179958 predicted 2019
10 SASI_Mm01_00179959 predicted 1152
11 SASI_Mm01_00179960 predicted 1926
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009535
VALIDATED
YES1 MISSION shRNA Bacterial Glycerol Stock
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000339150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1109s21c1
Sequence:CCGGGCGGAAAGATTACTTCTGAATCTCGAGATTCAGAAGTAATCTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1934s21c1
Sequence:CCGGGCTGCTCTGTATGGTCGATTTCTCGAGAAATCGACCATACAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1024s21c1
Sequence:CCGGTGGTTATATCCCTAGCAATTACTCGAGTAATTGCTAGGGATATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1532s21c1
Sequence:CCGGCCAGGTACAATGATGCCAGAACTCGAGTTCTGGCATCATTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1098s1c1
Sequence:CCGGGCGGAAAGATTACTTCTGAATCTCGAGATTCAGAAGTAATCTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1521s1c1
Sequence:CCGGCCAGGTACAATGATGCCAGAACTCGAGTTCTGGCATCATTGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-687s1c1
Sequence:CCGGGCCAGTCATTATGGAGTGGAACTCGAGTTCCACTCCATAATGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009535.1-889s1c1
Sequence:CCGGCCTTGTATGATTATGAAGCTACTCGAGTAGCTTCATAATCATACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1923s1c1
Sequence:CCGGGCTGCTCTGTATGGTCGATTTCTCGAGAAATCGACCATACAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009535
VALIDATED
YES1 MISSION shRNA shRNA Plasmid DNA
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000339150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1109s21c1
Sequence:CCGGGCGGAAAGATTACTTCTGAATCTCGAGATTCAGAAGTAATCTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1934s21c1
Sequence:CCGGGCTGCTCTGTATGGTCGATTTCTCGAGAAATCGACCATACAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1024s21c1
Sequence:CCGGTGGTTATATCCCTAGCAATTACTCGAGTAATTGCTAGGGATATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1532s21c1
Sequence:CCGGCCAGGTACAATGATGCCAGAACTCGAGTTCTGGCATCATTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1098s1c1
Sequence:CCGGGCGGAAAGATTACTTCTGAATCTCGAGATTCAGAAGTAATCTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1521s1c1
Sequence:CCGGCCAGGTACAATGATGCCAGAACTCGAGTTCTGGCATCATTGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-687s1c1
Sequence:CCGGGCCAGTCATTATGGAGTGGAACTCGAGTTCCACTCCATAATGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009535.1-889s1c1
Sequence:CCGGCCTTGTATGATTATGAAGCTACTCGAGTAGCTTCATAATCATACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1923s1c1
Sequence:CCGGGCTGCTCTGTATGGTCGATTTCTCGAGAAATCGACCATACAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009535
VALIDATED
YES1 MISSION shRNA Lentiviral Transduction Particles
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000339150    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1109s21c1
Sequence:CCGGGCGGAAAGATTACTTCTGAATCTCGAGATTCAGAAGTAATCTTTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1934s21c1
Sequence:CCGGGCTGCTCTGTATGGTCGATTTCTCGAGAAATCGACCATACAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1024s21c1
Sequence:CCGGTGGTTATATCCCTAGCAATTACTCGAGTAATTGCTAGGGATATAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339083    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_009535.2-1532s21c1
Sequence:CCGGCCAGGTACAATGATGCCAGAACTCGAGTTCTGGCATCATTGTACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1098s1c1
Sequence:CCGGGCGGAAAGATTACTTCTGAATCTCGAGATTCAGAAGTAATCTTTCCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023615    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1521s1c1
Sequence:CCGGCCAGGTACAATGATGCCAGAACTCGAGTTCTGGCATCATTGTACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023617    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-687s1c1
Sequence:CCGGGCCAGTCATTATGGAGTGGAACTCGAGTTCCACTCCATAATGACTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023618    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009535.1-889s1c1
Sequence:CCGGCCTTGTATGATTATGAAGCTACTCGAGTAGCTTCATAATCATACAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_009535.1-1923s1c1
Sequence:CCGGGCTGCTCTGTATGGTCGATTTCTCGAGAAATCGACCATACAGAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005433
VALIDATED
YES1 MISSION shRNA Bacterial Glycerol Stock
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Human
29 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-1803s1c1
Sequence:CCGGGACTACTTCACTGCTACAGAGCTCGAGCTCTGTAGCAGTGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-490s1c1
Sequence:CCGGCAGGTGGTGTTACTATATTTGCTCGAGCAAATATAGTAACACCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005433.3-2969s1c1
Sequence:CCGGGCTCCTCACTTAGCTATATTCCTCGAGGAATATAGCTAAGTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-943s1c1
Sequence:CCGGCAGAACATGCTGATGGTTTATCTCGAGATAAACCATCAGCATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-442s1c1
Sequence:CCGGCAATTATGTAGCGCCTGCAGACTCGAGTCTGCAGGCGCTACATAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-1337s1c1
Sequence:CCGGGCTGCACTGTATGGTCGGTTTCTCGAGAAACCGACCATACAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-1454s1c1
Sequence:CCGGCTAGAACAAGTGGAGCGAGGACTCGAGTCCTCGCTCCACTTGTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-427s1c1
Sequence:CCGGTGGTTATATCCCGAGCAATTACTCGAGTAATTGCTCGGGATATAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-905s1c1
Sequence:CCGGACCACGAAAGTAGCAATCAAACTCGAGTTTGATTGCTACTTTCGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-287s1c1
Sequence:CCGGGTTACTATATTTGTGGCCTTACTCGAGTAAGGCCACAAATATAGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-1338s1c1
Sequence:CCGGCTGCACTGTATGGTCGGTTTACTCGAGTAAACCGACCATACAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-161s1c1
Sequence:CCGGGCAGTTAATTTCAGCAGTCTTCTCGAGAAGACTGCTGAAATTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-3252s1c1
Sequence:CCGGCCAGCCTACATTCACTTCTAACTCGAGTTAGAAGTGAATGTAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000010019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-675s1c1
Sequence:CCGGACTATATCACAACCAGAGCACCTCGAGGTGCTCTGGTTGTGATATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-2173s1c1
Sequence:CCGGCCAAAGTCAGAATTGCTCAAACTCGAGTTTGAGCAATTCTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-744s1c1
Sequence:CCGGCCTGGAAATCAACGAGGTATTCTCGAGAATACCTCGTTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1473s1c1
Sequence:CCGGGCAAGGTTAATTGAAGACAATCTCGAGATTGTCTTCAATTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005433.3-480s1c1
Sequence:CCGGGCTGGTTTAACAGGTGGTGTTCTCGAGAACACCACCTGTTAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-4030s1c1
Sequence:CCGGGCTGTCATTATTTCCTCTTATCTCGAGATAAGAGGAAATAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1038s1c1
Sequence:CCGGCCTCGAGAATCTTTGCGACTACTCGAGTAGTCGCAAAGATTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-669s1c1
Sequence:CCGGGCAGATTCCATTCAGGCAGAACTCGAGTTCTGCCTGAATGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-953s1c1
Sequence:CCGGTGATGGTTTATGCCACAAGTTCTCGAGAACTTGTGGCATAAACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005433.3-466s1c1
Sequence:CCGGCAAGTTCATATCCTGCTGGTTCTCGAGAACCAGCAGGATATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-2684s1c1
Sequence:CCGGGCAAAGTAAGACCCAGCATTTCTCGAGAAATGCTGGGTCTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1351s1c1
Sequence:CCGGCTGCTCAGATTGCTGATGGTACTCGAGTACCATCAGCAATCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1719s1c1
Sequence:CCGGTCCCTCCATGAATTGATGAATCTCGAGATTCATCAATTCATGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-537s1c1
Sequence:CCGGACTACAGAAGACCTTTCATTTCTCGAGAAATGAAAGGTCTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1362s1c1
Sequence:CCGGGCTGATGGTATGGCATATATTCTCGAGAATATATGCCATACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1604s1c1
Sequence:CCGGGCAAACAGAACTAGTAACAAACTCGAGTTTGTTACTAGTTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005433
VALIDATED
YES1 MISSION shRNA shRNA Plasmid DNA
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Human
29 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-1803s1c1
Sequence:CCGGGACTACTTCACTGCTACAGAGCTCGAGCTCTGTAGCAGTGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-490s1c1
Sequence:CCGGCAGGTGGTGTTACTATATTTGCTCGAGCAAATATAGTAACACCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005433.3-2969s1c1
Sequence:CCGGGCTCCTCACTTAGCTATATTCCTCGAGGAATATAGCTAAGTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-943s1c1
Sequence:CCGGCAGAACATGCTGATGGTTTATCTCGAGATAAACCATCAGCATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-442s1c1
Sequence:CCGGCAATTATGTAGCGCCTGCAGACTCGAGTCTGCAGGCGCTACATAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-1337s1c1
Sequence:CCGGGCTGCACTGTATGGTCGGTTTCTCGAGAAACCGACCATACAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-1454s1c1
Sequence:CCGGCTAGAACAAGTGGAGCGAGGACTCGAGTCCTCGCTCCACTTGTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-427s1c1
Sequence:CCGGTGGTTATATCCCGAGCAATTACTCGAGTAATTGCTCGGGATATAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-905s1c1
Sequence:CCGGACCACGAAAGTAGCAATCAAACTCGAGTTTGATTGCTACTTTCGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-287s1c1
Sequence:CCGGGTTACTATATTTGTGGCCTTACTCGAGTAAGGCCACAAATATAGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-1338s1c1
Sequence:CCGGCTGCACTGTATGGTCGGTTTACTCGAGTAAACCGACCATACAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-161s1c1
Sequence:CCGGGCAGTTAATTTCAGCAGTCTTCTCGAGAAGACTGCTGAAATTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-3252s1c1
Sequence:CCGGCCAGCCTACATTCACTTCTAACTCGAGTTAGAAGTGAATGTAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000010019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-675s1c1
Sequence:CCGGACTATATCACAACCAGAGCACCTCGAGGTGCTCTGGTTGTGATATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-2173s1c1
Sequence:CCGGCCAAAGTCAGAATTGCTCAAACTCGAGTTTGAGCAATTCTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-744s1c1
Sequence:CCGGCCTGGAAATCAACGAGGTATTCTCGAGAATACCTCGTTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1473s1c1
Sequence:CCGGGCAAGGTTAATTGAAGACAATCTCGAGATTGTCTTCAATTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005433.3-480s1c1
Sequence:CCGGGCTGGTTTAACAGGTGGTGTTCTCGAGAACACCACCTGTTAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-4030s1c1
Sequence:CCGGGCTGTCATTATTTCCTCTTATCTCGAGATAAGAGGAAATAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1038s1c1
Sequence:CCGGCCTCGAGAATCTTTGCGACTACTCGAGTAGTCGCAAAGATTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-669s1c1
Sequence:CCGGGCAGATTCCATTCAGGCAGAACTCGAGTTCTGCCTGAATGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-953s1c1
Sequence:CCGGTGATGGTTTATGCCACAAGTTCTCGAGAACTTGTGGCATAAACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005433.3-466s1c1
Sequence:CCGGCAAGTTCATATCCTGCTGGTTCTCGAGAACCAGCAGGATATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-2684s1c1
Sequence:CCGGGCAAAGTAAGACCCAGCATTTCTCGAGAAATGCTGGGTCTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1351s1c1
Sequence:CCGGCTGCTCAGATTGCTGATGGTACTCGAGTACCATCAGCAATCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1719s1c1
Sequence:CCGGTCCCTCCATGAATTGATGAATCTCGAGATTCATCAATTCATGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-537s1c1
Sequence:CCGGACTACAGAAGACCTTTCATTTCTCGAGAAATGAAAGGTCTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1362s1c1
Sequence:CCGGGCTGATGGTATGGCATATATTCTCGAGAATATATGCCATACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1604s1c1
Sequence:CCGGGCAAACAGAACTAGTAACAAACTCGAGTTTGTTACTAGTTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005433
VALIDATED
YES1 MISSION shRNA Lentiviral Transduction Particles
v-yes-1 Yamaguchi sarcoma viral oncogene homolog 1
Human
29 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197092    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-1803s1c1
Sequence:CCGGGACTACTTCACTGCTACAGAGCTCGAGCTCTGTAGCAGTGAAGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195217    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-490s1c1
Sequence:CCGGCAGGTGGTGTTACTATATTTGCTCGAGCAAATATAGTAACACCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196418    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_005433.3-2969s1c1
Sequence:CCGGGCTCCTCACTTAGCTATATTCCTCGAGGAATATAGCTAAGTGAGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194696    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005433.3-943s1c1
Sequence:CCGGCAGAACATGCTGATGGTTTATCTCGAGATAAACCATCAGCATGTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010015    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-442s1c1
Sequence:CCGGCAATTATGTAGCGCCTGCAGACTCGAGTCTGCAGGCGCTACATAATTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010004    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-1337s1c1
Sequence:CCGGGCTGCACTGTATGGTCGGTTTCTCGAGAAACCGACCATACAGTGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010005    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-1454s1c1
Sequence:CCGGCTAGAACAAGTGGAGCGAGGACTCGAGTCCTCGCTCCACTTGTTCTAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010006    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-427s1c1
Sequence:CCGGTGGTTATATCCCGAGCAATTACTCGAGTAATTGCTCGGGATATAACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001611    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-905s1c1
Sequence:CCGGACCACGAAAGTAGCAATCAAACTCGAGTTTGATTGCTACTTTCGTGGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-287s1c1
Sequence:CCGGGTTACTATATTTGTGGCCTTACTCGAGTAAGGCCACAAATATAGTAACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001609    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-1338s1c1
Sequence:CCGGCTGCACTGTATGGTCGGTTTACTCGAGTAAACCGACCATACAGTGCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-161s1c1
Sequence:CCGGGCAGTTAATTTCAGCAGTCTTCTCGAGAAGACTGCTGAAATTAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001607    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.x-3252s1c1
Sequence:CCGGCCAGCCTACATTCACTTCTAACTCGAGTTAGAAGTGAATGTAGGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000010019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005433.x-675s1c1
Sequence:CCGGACTATATCACAACCAGAGCACCTCGAGGTGCTCTGGTTGTGATATAGTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121242    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-2173s1c1
Sequence:CCGGCCAAAGTCAGAATTGCTCAAACTCGAGTTTGAGCAATTCTGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-744s1c1
Sequence:CCGGCCTGGAAATCAACGAGGTATTCTCGAGAATACCTCGTTGATTTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1473s1c1
Sequence:CCGGGCAAGGTTAATTGAAGACAATCTCGAGATTGTCTTCAATTAACCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005433.3-480s1c1
Sequence:CCGGGCTGGTTTAACAGGTGGTGTTCTCGAGAACACCACCTGTTAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121062    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-4030s1c1
Sequence:CCGGGCTGTCATTATTTCCTCTTATCTCGAGATAAGAGGAAATAATGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121231    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1038s1c1
Sequence:CCGGCCTCGAGAATCTTTGCGACTACTCGAGTAGTCGCAAAGATTCTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121230    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-669s1c1
Sequence:CCGGGCAGATTCCATTCAGGCAGAACTCGAGTTCTGCCTGAATGGAATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121229    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-953s1c1
Sequence:CCGGTGATGGTTTATGCCACAAGTTCTCGAGAACTTGTGGCATAAACCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005433.3-466s1c1
Sequence:CCGGCAAGTTCATATCCTGCTGGTTCTCGAGAACCAGCAGGATATGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121227    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-2684s1c1
Sequence:CCGGGCAAAGTAAGACCCAGCATTTCTCGAGAAATGCTGGGTCTTACTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1351s1c1
Sequence:CCGGCTGCTCAGATTGCTGATGGTACTCGAGTACCATCAGCAATCTGAGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121244    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1719s1c1
Sequence:CCGGTCCCTCCATGAATTGATGAATCTCGAGATTCATCAATTCATGGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121245    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-537s1c1
Sequence:CCGGACTACAGAAGACCTTTCATTTCTCGAGAAATGAAAGGTCTTCTGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121243    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1362s1c1
Sequence:CCGGGCTGATGGTATGGCATATATTCTCGAGAATATATGCCATACCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121246    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_005433.3-1604s1c1
Sequence:CCGGGCAAACAGAACTAGTAACAAACTCGAGTTTGTTACTAGTTCTGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks