EMAIL THIS PAGE TO A FRIEND

YIF1A

Yip1 interacting factor homolog A (S. cerevisiae)

Synonyms: 54TM FinGER7 YIF1 YIF1P
UniProtKB ID: O95070, A6NM00, Q96G83, Q9BVD0
Gene ID:
Mouse(68090) Yip1 interacting factor homolog A (S. cerevisiae)
Rat(171441) Yip1 interacting factor homolog A (S. cerevisiae)
Zebrafish(334982) Yip1 interacting factor homolog A (S. cerevisiae)
domestic cat(101083546) Yip1 interacting factor homolog A (S. cerevisiae)
Horse(100052354) Yip1 interacting factor homolog A (S. cerevisiae)
dog(476014) Yip1 interacting factor homolog A (S. cerevisiae)
cow(506336) Yip1 interacting factor homolog A (S. cerevisiae)
sheep(101113446) Yip1 interacting factor homolog A (S. cerevisiae)
domestic guinea pig(100727936) Yip1 interacting factor homolog A (S. cerevisiae)
naked mole-rat(101698252) Yip1 interacting factor homolog A (S. cerevisiae)
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026553 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026553 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026553 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020470 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020470 Rosetta Predictions human pricing
NM_172017 Rosetta Predictions rat pricing
NM_026553 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00101807 predicted 888
2 SASI_Hs01_00101808 predicted 397
3 SASI_Hs01_00101809 predicted 434
4 SASI_Hs01_00101810 predicted 800
5 SASI_Hs01_00101811 predicted 436
6 SASI_Hs02_00353546 predicted 320
7 SASI_Hs01_00101812 predicted 354
8 SASI_Hs02_00353547 predicted 261
9 SASI_Hs01_00101814 predicted 308
10 SASI_Hs01_00101815 predicted 360
11 SASI_Hs01_00101813 predicted 407
12 SASI_Hs01_00101816 predicted 753
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00269102 predicted 760
2 SASI_Rn01_00046181 predicted 555
3 SASI_Rn02_00269103 predicted 768
4 SASI_Rn01_00046184 predicted 285
5 SASI_Rn02_00269104 predicted 614
6 SASI_Rn02_00269105 predicted 330
7 SASI_Rn02_00269106 predicted 323
8 SASI_Rn01_00046186 predicted 287
9 SASI_Rn01_00046187 predicted 472
10 SASI_Rn01_00046188 predicted 452
11 SASI_Rn01_00046180 predicted 709
12 SASI_Rn01_00046182 predicted 225
13 SASI_Rn01_00046183 predicted 717
14 SASI_Rn01_00046185 predicted 261
15 SASI_Rn01_00046189 predicted 723
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026553 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00195594 predicted 1206
2 SASI_Mm01_00195595 predicted 415
3 SASI_Mm01_00195596 predicted 1174
4 SASI_Mm01_00195597 predicted 334
5 SASI_Mm02_00330482 predicted 481
6 SASI_Mm02_00330483 predicted 613
7 SASI_Mm01_00195601 predicted 396
8 SASI_Mm01_00195602 predicted 755
9 SASI_Mm01_00195603 predicted 456
10 SASI_Mm02_00330484 predicted 347
11 SASI_Mm01_00195598 predicted 1060
12 SASI_Mm01_00195599 predicted 1045
13 SASI_Mm01_00195600 predicted 694
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026553
YIF1A MISSION shRNA Bacterial Glycerol Stock
Yip1 interacting factor homolog A (S. cerevisiae)
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000193336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-427s1c1
Sequence:CCGGCGTGAACAAACTCAAGTATTTCTCGAGAAATACTTGAGTTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026553.2-1083s1c1
Sequence:CCGGCATTGAAGATTTGGTTTCCTTCTCGAGAAGGAAACCAAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-426s1c1
Sequence:CCGGCCGTGAACAAACTCAAGTATTCTCGAGAATACTTGAGTTTGTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026553.2-1139s1c1
Sequence:CCGGGAAGCCATAGGTATCTGCTTTCTCGAGAAAGCAGATACCTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-1012s1c1
Sequence:CCGGCATCATATACTGGCTGACCTTCTCGAGAAGGTCAGCCAGTATATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-884s1c1
Sequence:CCGGGCGCTTATGTACTTCATTGTACTCGAGTACAATGAAGTACATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026553
YIF1A MISSION shRNA shRNA Plasmid DNA
Yip1 interacting factor homolog A (S. cerevisiae)
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000193336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-427s1c1
Sequence:CCGGCGTGAACAAACTCAAGTATTTCTCGAGAAATACTTGAGTTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026553.2-1083s1c1
Sequence:CCGGCATTGAAGATTTGGTTTCCTTCTCGAGAAGGAAACCAAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-426s1c1
Sequence:CCGGCCGTGAACAAACTCAAGTATTCTCGAGAATACTTGAGTTTGTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026553.2-1139s1c1
Sequence:CCGGGAAGCCATAGGTATCTGCTTTCTCGAGAAAGCAGATACCTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-1012s1c1
Sequence:CCGGCATCATATACTGGCTGACCTTCTCGAGAAGGTCAGCCAGTATATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-884s1c1
Sequence:CCGGGCGCTTATGTACTTCATTGTACTCGAGTACAATGAAGTACATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026553
YIF1A MISSION shRNA Lentiviral Transduction Particles
Yip1 interacting factor homolog A (S. cerevisiae)
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000193336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-427s1c1
Sequence:CCGGCGTGAACAAACTCAAGTATTTCTCGAGAAATACTTGAGTTTGTTCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193232    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026553.2-1083s1c1
Sequence:CCGGCATTGAAGATTTGGTTTCCTTCTCGAGAAGGAAACCAAATCTTCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193203    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-426s1c1
Sequence:CCGGCCGTGAACAAACTCAAGTATTCTCGAGAATACTTGAGTTTGTTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175818    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_026553.2-1139s1c1
Sequence:CCGGGAAGCCATAGGTATCTGCTTTCTCGAGAAAGCAGATACCTATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175316    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-1012s1c1
Sequence:CCGGCATCATATACTGGCTGACCTTCTCGAGAAGGTCAGCCAGTATATGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174727    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026553.2-884s1c1
Sequence:CCGGGCGCTTATGTACTTCATTGTACTCGAGTACAATGAAGTACATAAGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020470
YIF1A MISSION shRNA Bacterial Glycerol Stock
Yip1 interacting factor homolog A (S. cerevisiae)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-731s1c1
Sequence:CCGGGCCTACAGTGGCTACAAATACCTCGAGGTATTTGTAGCCACTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-544s1c1
Sequence:CCGGGAAGGCCTTCATTACTTACGTCTCGAGACGTAAGTAATGAAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-373s1c1
Sequence:CCGGGTCTGTGAGCAAACTCAAGTACTCGAGTACTTGAGTTTGCTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-841s1c1
Sequence:CCGGGTACTTCATTGTGCGCTCTTTCTCGAGAAAGAGCGCACAATGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-194s1c1
Sequence:CCGGGATGACACAAGCGGTGGTTATCTCGAGATAACCACCGCTTGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-259s1c1
Sequence:CCGGCTTCAGTGTCAACCACTTGCTCTCGAGAGCAAGTGGTTGACACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-738s1c1
Sequence:CCGGGTGGCTACAAATACGTGGGAACTCGAGTTCCCACGTATTTGTAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-741s1c1
Sequence:CCGGGCTACAAATACGTGGGAATGACTCGAGTCATTCCCACGTATTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-756s1c1
Sequence:CCGGGAATGATCCTCAGTGTGCTCACTCGAGTGAGCACACTGAGGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-540s1c1
Sequence:CCGGCCACGAAGGCCTTCATTACTTCTCGAGAAGTAATGAAGGCCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-470s1c1
Sequence:CCGGGAAGTGCAGTACAGTCGTGATCTCGAGATCACGACTGTACTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-644s21c1
Sequence:CCGGGATGGCACTGGGCATTCAGAACTCGAGTTCTGAATGCCCAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-609s21c1
Sequence:CCGGACGATGGCCTTCATTACTTACCTCGAGGTAAGTAATGAAGGCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-476s21c1
Sequence:CCGGCACAGCCTACGTGGCCAAGAACTCGAGTTCTTGGCCACGTAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020470
YIF1A MISSION shRNA shRNA Plasmid DNA
Yip1 interacting factor homolog A (S. cerevisiae)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-731s1c1
Sequence:CCGGGCCTACAGTGGCTACAAATACCTCGAGGTATTTGTAGCCACTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-544s1c1
Sequence:CCGGGAAGGCCTTCATTACTTACGTCTCGAGACGTAAGTAATGAAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-373s1c1
Sequence:CCGGGTCTGTGAGCAAACTCAAGTACTCGAGTACTTGAGTTTGCTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-841s1c1
Sequence:CCGGGTACTTCATTGTGCGCTCTTTCTCGAGAAAGAGCGCACAATGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-194s1c1
Sequence:CCGGGATGACACAAGCGGTGGTTATCTCGAGATAACCACCGCTTGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-259s1c1
Sequence:CCGGCTTCAGTGTCAACCACTTGCTCTCGAGAGCAAGTGGTTGACACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-738s1c1
Sequence:CCGGGTGGCTACAAATACGTGGGAACTCGAGTTCCCACGTATTTGTAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-741s1c1
Sequence:CCGGGCTACAAATACGTGGGAATGACTCGAGTCATTCCCACGTATTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-756s1c1
Sequence:CCGGGAATGATCCTCAGTGTGCTCACTCGAGTGAGCACACTGAGGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-540s1c1
Sequence:CCGGCCACGAAGGCCTTCATTACTTCTCGAGAAGTAATGAAGGCCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-470s1c1
Sequence:CCGGGAAGTGCAGTACAGTCGTGATCTCGAGATCACGACTGTACTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-644s21c1
Sequence:CCGGGATGGCACTGGGCATTCAGAACTCGAGTTCTGAATGCCCAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-609s21c1
Sequence:CCGGACGATGGCCTTCATTACTTACCTCGAGGTAAGTAATGAAGGCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-476s21c1
Sequence:CCGGCACAGCCTACGTGGCCAAGAACTCGAGTTCTTGGCCACGTAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020470
YIF1A MISSION shRNA Lentiviral Transduction Particles
Yip1 interacting factor homolog A (S. cerevisiae)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166542    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-731s1c1
Sequence:CCGGGCCTACAGTGGCTACAAATACCTCGAGGTATTTGTAGCCACTGTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163040    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-544s1c1
Sequence:CCGGGAAGGCCTTCATTACTTACGTCTCGAGACGTAAGTAATGAAGGCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163369    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-373s1c1
Sequence:CCGGGTCTGTGAGCAAACTCAAGTACTCGAGTACTTGAGTTTGCTCACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-841s1c1
Sequence:CCGGGTACTTCATTGTGCGCTCTTTCTCGAGAAAGAGCGCACAATGAAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165134    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-194s1c1
Sequence:CCGGGATGACACAAGCGGTGGTTATCTCGAGATAACCACCGCTTGTGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164820    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-259s1c1
Sequence:CCGGCTTCAGTGTCAACCACTTGCTCTCGAGAGCAAGTGGTTGACACTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166010    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-738s1c1
Sequence:CCGGGTGGCTACAAATACGTGGGAACTCGAGTTCCCACGTATTTGTAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163688    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-741s1c1
Sequence:CCGGGCTACAAATACGTGGGAATGACTCGAGTCATTCCCACGTATTTGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165344    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-756s1c1
Sequence:CCGGGAATGATCCTCAGTGTGCTCACTCGAGTGAGCACACTGAGGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166255    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-540s1c1
Sequence:CCGGCCACGAAGGCCTTCATTACTTCTCGAGAAGTAATGAAGGCCTTCGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166292    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020470.1-470s1c1
Sequence:CCGGGAAGTGCAGTACAGTCGTGATCTCGAGATCACGACTGTACTGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436214    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-644s21c1
Sequence:CCGGGATGGCACTGGGCATTCAGAACTCGAGTTCTGAATGCCCAGTGCCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428164    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-609s21c1
Sequence:CCGGACGATGGCCTTCATTACTTACCTCGAGGTAAGTAATGAAGGCCATCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020470.2-476s21c1
Sequence:CCGGCACAGCCTACGTGGCCAAGAACTCGAGTTCTTGGCCACGTAGGCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks