EMAIL THIS PAGE TO A FRIEND

YIF1B

Yip1 interacting factor homolog B (S. cerevisiae)

Synonyms: FinGER8
UniProtKB ID: Q5BJH7, H7BXS8, Q5JPC2, Q8WY70, Q96C02, Q96IC4
Gene ID:
Mouse(77254) Yip1 interacting factor homolog B (S. cerevisiae)
Rat(292768) Yip1 interacting factor homolog B (S. cerevisiae)
naked mole-rat(101704502) Yip1 interacting factor homolog B (S. cerevisiae)
domestic guinea pig(100731544) Yip1 interacting factor homolog B (S. cerevisiae)
cow(617320) Yip1 interacting factor homolog B (S. cerevisiae)
sheep(101111045) Yip1 interacting factor homolog B (S. cerevisiae)
Zebrafish(492462) Yip1 interacting factor homolog B (S. cerevisiae)
Horse(100052293) Yip1 interacting factor homolog B (S. cerevisiae)
domestic cat(101096190) Yip1 interacting factor homolog B (S. cerevisiae)
dog(484532) Yip1 interacting factor homolog B (S. cerevisiae)
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033557 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033557 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033557 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029887 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029887 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029887 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039671 Rosetta Predictions human pricing
NM_001039672 Rosetta Predictions human pricing
NM_001039673 Rosetta Predictions human pricing
NM_033557 Rosetta Predictions human pricing
NM_001014810 Rosetta Predictions rat pricing
NM_198734 Rosetta Predictions rat pricing
NM_001110201 Rosetta Predictions mouse pricing
NM_029887 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039671 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308633 predicted 345
2 SASI_Hs01_00239792 predicted 345
3 SASI_Hs01_00239793 predicted 620
4 SASI_Hs01_00239794 predicted 472
5 SASI_Hs01_00239795 predicted 485
6 SASI_Hs01_00239796 predicted 646
7 SASI_Hs01_00239798 predicted 671
8 SASI_Hs01_00239799 predicted 613
9 SASI_Hs01_00239800 predicted 674
10 SASI_Hs01_00239801 predicted 321
11 SASI_Hs01_00239797 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039672 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308634 predicted 390
2 SASI_Hs01_00045004 predicted 387
3 SASI_Hs01_00045005 predicted 669
4 SASI_Hs01_00045006 predicted 522
5 SASI_Hs01_00045007 predicted 528
6 SASI_Hs01_00045008 predicted 702
7 SASI_Hs01_00045010 predicted 727
8 SASI_Hs01_00045011 predicted 665
9 SASI_Hs01_00045012 predicted 727
10 SASI_Hs01_00045013 predicted 365
11 SASI_Hs01_00045009 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039673 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00308635 predicted 387
2 SASI_Hs01_00222761 predicted 387
3 SASI_Hs01_00222762 predicted 661
4 SASI_Hs01_00222763 predicted 514
5 SASI_Hs01_00222764 predicted 521
6 SASI_Hs01_00222765 predicted 687
7 SASI_Hs01_00222767 predicted 717
8 SASI_Hs01_00222768 predicted 659
9 SASI_Hs01_00222769 predicted 710
10 SASI_Hs01_00222770 predicted 354
11 SASI_Hs01_00222766 predicted 367
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033557 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00361430 predicted 513
2 SASI_Hs01_00068315 predicted 507
3 SASI_Hs01_00068316 predicted 781
4 SASI_Hs01_00068317 predicted 641
5 SASI_Hs01_00068318 predicted 647
6 SASI_Hs01_00068319 predicted 815
7 SASI_Hs01_00068321 predicted 847
8 SASI_Hs01_00068322 predicted 780
9 SASI_Hs01_00068323 predicted 842
10 SASI_Hs01_00068324 predicted 489
11 SASI_Hs01_00068320 predicted 493
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014810 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082986 predicted 878
2 SASI_Rn01_00082987 predicted 392
3 SASI_Rn01_00082988 predicted 332
4 SASI_Rn01_00082990 predicted 925
5 SASI_Rn01_00082991 predicted 318
6 SASI_Rn01_00082992 predicted 818
7 SASI_Rn01_00082993 predicted 291
8 SASI_Rn02_00201907 predicted 792
9 SASI_Rn01_00082994 predicted 631
10 SASI_Rn01_00082995 predicted 616
11 SASI_Rn01_00082989 predicted 690
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198734 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034155 predicted 885
2 SASI_Rn01_00034156 predicted 396
3 SASI_Rn01_00034157 predicted 347
4 SASI_Rn01_00034159 predicted 937
5 SASI_Rn01_00034160 predicted 330
6 SASI_Rn01_00034161 predicted 828
7 SASI_Rn01_00034162 predicted 297
8 SASI_Rn02_00269942 predicted 802
9 SASI_Rn01_00034163 predicted 646
10 SASI_Rn01_00034164 predicted 631
11 SASI_Rn01_00034158 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001110201 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00304886 predicted 661
2 SASI_Mm02_00304887 predicted 812
3 SASI_Mm02_00304888 predicted 356
4 SASI_Mm02_00304889 predicted 638
5 SASI_Mm02_00304890 predicted 898
6 SASI_Mm02_00304891 predicted 660
7 SASI_Mm02_00304892 predicted 365
8 SASI_Mm02_00304893 predicted 809
9 SASI_Mm02_00304894 predicted 757
10 SASI_Mm02_00304895 predicted 812
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029887 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025798 predicted 670
2 SASI_Mm01_00025799 predicted 816
3 SASI_Mm02_00336127 predicted 373
4 SASI_Mm02_00336128 predicted 642
5 SASI_Mm01_00025801 predicted 906
6 SASI_Mm02_00336129 predicted 666
7 SASI_Mm02_00336130 predicted 376
8 SASI_Mm01_00025802 predicted 816
9 SASI_Mm01_00025804 predicted 765
10 SASI_Mm01_00025806 predicted 816
11 SASI_Mm01_00025797 predicted 828
12 SASI_Mm01_00025800 predicted 800
13 SASI_Mm01_00025803 predicted 805
14 SASI_Mm01_00025805 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033557
YIF1B MISSION shRNA Bacterial Glycerol Stock
Yip1 interacting factor homolog B (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-459s21c1
Sequence:CCGGTAAGAACATCGACCGCTTCATCTCGAGATGAAGCGGTCGATGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-653s21c1
Sequence:CCGGTGGCTTTCATCACCTACGTTTCTCGAGAAACGTAGGTGATGAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-836s21c1
Sequence:CCGGTGGCCTTCTTGGGCTACAAATCTCGAGATTTGTAGCCCAAGAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-483s21c1
Sequence:CCGGCATCACCAAGCTCAAGTATTACTCGAGTAATACTTGAGCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033557.1-862s1c1
Sequence:CCGGCGTAGCCATCTTTGTGTTCATCTCGAGATGAACACAAAGATGGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033557
YIF1B MISSION shRNA shRNA Plasmid DNA
Yip1 interacting factor homolog B (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-459s21c1
Sequence:CCGGTAAGAACATCGACCGCTTCATCTCGAGATGAAGCGGTCGATGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-653s21c1
Sequence:CCGGTGGCTTTCATCACCTACGTTTCTCGAGAAACGTAGGTGATGAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-836s21c1
Sequence:CCGGTGGCCTTCTTGGGCTACAAATCTCGAGATTTGTAGCCCAAGAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-483s21c1
Sequence:CCGGCATCACCAAGCTCAAGTATTACTCGAGTAATACTTGAGCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033557.1-862s1c1
Sequence:CCGGCGTAGCCATCTTTGTGTTCATCTCGAGATGAACACAAAGATGGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033557
YIF1B MISSION shRNA Lentiviral Transduction Particles
Yip1 interacting factor homolog B (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-459s21c1
Sequence:CCGGTAAGAACATCGACCGCTTCATCTCGAGATGAAGCGGTCGATGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-653s21c1
Sequence:CCGGTGGCTTTCATCACCTACGTTTCTCGAGAAACGTAGGTGATGAAAGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-836s21c1
Sequence:CCGGTGGCCTTCTTGGGCTACAAATCTCGAGATTTGTAGCCCAAGAAGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033557.2-483s21c1
Sequence:CCGGCATCACCAAGCTCAAGTATTACTCGAGTAATACTTGAGCTTGGTGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179907    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_033557.1-862s1c1
Sequence:CCGGCGTAGCCATCTTTGTGTTCATCTCGAGATGAACACAAAGATGGCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029887
VALIDATED
YIF1B MISSION shRNA Bacterial Glycerol Stock
Yip1 interacting factor homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029887.1-756s1c1
Sequence:CCGGCTTTGGAAAGATCGGCTACTACTCGAGTAGTAGCCGATCTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-475s1c1
Sequence:CCGGCGCTTTGACATCAATGCTCCACTCGAGTGGAGCATTGATGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-621s1c1
Sequence:CCGGGACTCTGAAAGTCGTAGCAATCTCGAGATTGCTACGACTTTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029887.1-345s1c1
Sequence:CCGGCGTCAGCAAGCTCAAGTATTACTCGAGTAATACTTGAGCTTGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-81s1c1
Sequence:CCGGGCTGCGTAAGTGGCCCTCAAACTCGAGTTTGAGGGCCACTTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029887
VALIDATED
YIF1B MISSION shRNA shRNA Plasmid DNA
Yip1 interacting factor homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029887.1-756s1c1
Sequence:CCGGCTTTGGAAAGATCGGCTACTACTCGAGTAGTAGCCGATCTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-475s1c1
Sequence:CCGGCGCTTTGACATCAATGCTCCACTCGAGTGGAGCATTGATGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-621s1c1
Sequence:CCGGGACTCTGAAAGTCGTAGCAATCTCGAGATTGCTACGACTTTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029887.1-345s1c1
Sequence:CCGGCGTCAGCAAGCTCAAGTATTACTCGAGTAATACTTGAGCTTGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-81s1c1
Sequence:CCGGGCTGCGTAAGTGGCCCTCAAACTCGAGTTTGAGGGCCACTTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029887
VALIDATED
YIF1B MISSION shRNA Lentiviral Transduction Particles
Yip1 interacting factor homolog B (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029887.1-756s1c1
Sequence:CCGGCTTTGGAAAGATCGGCTACTACTCGAGTAGTAGCCGATCTTTCCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-475s1c1
Sequence:CCGGCGCTTTGACATCAATGCTCCACTCGAGTGGAGCATTGATGTCAAAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126172    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-621s1c1
Sequence:CCGGGACTCTGAAAGTCGTAGCAATCTCGAGATTGCTACGACTTTCAGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029887.1-345s1c1
Sequence:CCGGCGTCAGCAAGCTCAAGTATTACTCGAGTAATACTTGAGCTTGCTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029887.1-81s1c1
Sequence:CCGGGCTGCGTAAGTGGCCCTCAAACTCGAGTTTGAGGGCCACTTACGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks