EMAIL THIS PAGE TO A FRIEND

YIPF1

Yip1 domain family, member 1

Synonyms: DJ167A19.1 FinGER1
UniProtKB ID: Q9Y548, B2RCM7, D3DQ40, Q9NWJ1
Gene ID:
Mouse(230584) Yip1 domain family, member 1
Rat(298312) Yip1 domain family, member 1
Zebrafish(445484) Yip1 domain family, member 1
dog(489581) Yip1 domain family, member 1
Horse(100050435) Yip1 domain family, member 1
domestic cat(101095115) Yip1 domain family, member 1
chicken(424653) Yip1 domain family, member 1
cow(511748) Yip1 domain family, member 1
sheep(101119771) Yip1 domain family, member 1
domestic guinea pig(100735993) Yip1 domain family, member 1
naked mole-rat(101706154) Yip1 domain family, member 1
45 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV49420 Anti-YIPF1 antibody produced in rabbit affinity isolated antibody canine, bovine, human, guinea pig, horse, mouse, rat, pig, rabbit
western blot pricing
SAB1307027 ANTI-YIPF1(N-TERMINAL) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018982 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018982 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018982 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145550 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145550 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145550 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044401 MISSION® esiRNA esiRNA human YIPF1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018982 Rosetta Predictions human pricing
NM_199383 Rosetta Predictions rat pricing
NM_145550 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018982 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352480 predicted 726
2 SASI_Hs01_00188441 predicted 523
3 SASI_Hs01_00188442 predicted 1244
4 SASI_Hs01_00188443 predicted 1119
5 SASI_Hs01_00188444 predicted 1000
6 SASI_Hs01_00188445 predicted 946
7 SASI_Hs01_00188446 predicted 776
8 SASI_Hs01_00188447 predicted 483
9 SASI_Hs01_00188448 predicted 904
10 SASI_Hs01_00188449 predicted 417
11 SASI_Hs01_00188450 predicted 618
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113891 predicted 320
2 SASI_Rn01_00113892 predicted 522
3 SASI_Rn01_00113893 predicted 703
4 SASI_Rn01_00113894 predicted 505
5 SASI_Rn01_00113895 predicted 538
6 SASI_Rn01_00113896 predicted 308
7 SASI_Rn01_00113898 predicted 510
8 SASI_Rn01_00113899 predicted 443
9 SASI_Rn02_00270197 predicted 1021
10 SASI_Rn01_00113900 predicted 1028
11 SASI_Rn01_00113897 predicted 580
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145550 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00026917 predicted 267
2 SASI_Mm01_00026918 predicted 299
3 SASI_Mm01_00026919 predicted 260
4 SASI_Mm01_00026920 predicted 972
5 SASI_Mm01_00026921 predicted 539
6 SASI_Mm01_00026922 predicted 481
7 SASI_Mm01_00026924 predicted 520
8 SASI_Mm01_00026925 predicted 944
9 SASI_Mm02_00341040 predicted 411
10 SASI_Mm01_00026926 predicted 965
11 SASI_Mm01_00026923 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018982
VALIDATED
YIPF1 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018982.3-667s1c1
Sequence:CCGGGAGGTTATATATCCGCAGCAACTCGAGTTGCTGCGGATATATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-734s1c1
Sequence:CCGGGCCATAGCAATTAGTGGGAATCTCGAGATTCCCACTAATTGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-1124s1c1
Sequence:CCGGGTGACAATTGTGTTGCTCCATCTCGAGATGGAGCAACACAATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018982.3-1549s1c1
Sequence:CCGGGCCACCACAGTCAAATGACATCTCGAGATGTCATTTGACTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018982.3-1223s1c1
Sequence:CCGGCCAAACCAAACAGTTGCTGCACTCGAGTGCAGCAACTGTTTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018982.3-789s1c1
Sequence:CCGGCGTACCATTATGTGCCCGAATCTCGAGATTCGGGCACATAATGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-611s1c1
Sequence:CCGGCAGGTCTTTGACAGAATTAAACTCGAGTTTAATTCTGTCAAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-1592s1c1
Sequence:CCGGCCTGAAATAGAACCATGGAAACTCGAGTTTCCATGGTTCTATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-905s1c1
Sequence:CCGGGTTATGAACATCGTCTCCTATCTCGAGATAGGAGACGATGTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018982.3-491s1c1
Sequence:CCGGGATGATGAGTTACTGGGAAATCTCGAGATTTCCCAGTAACTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018982
VALIDATED
YIPF1 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018982.3-667s1c1
Sequence:CCGGGAGGTTATATATCCGCAGCAACTCGAGTTGCTGCGGATATATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-734s1c1
Sequence:CCGGGCCATAGCAATTAGTGGGAATCTCGAGATTCCCACTAATTGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-1124s1c1
Sequence:CCGGGTGACAATTGTGTTGCTCCATCTCGAGATGGAGCAACACAATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018982.3-1549s1c1
Sequence:CCGGGCCACCACAGTCAAATGACATCTCGAGATGTCATTTGACTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018982.3-1223s1c1
Sequence:CCGGCCAAACCAAACAGTTGCTGCACTCGAGTGCAGCAACTGTTTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018982.3-789s1c1
Sequence:CCGGCGTACCATTATGTGCCCGAATCTCGAGATTCGGGCACATAATGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-611s1c1
Sequence:CCGGCAGGTCTTTGACAGAATTAAACTCGAGTTTAATTCTGTCAAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-1592s1c1
Sequence:CCGGCCTGAAATAGAACCATGGAAACTCGAGTTTCCATGGTTCTATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-905s1c1
Sequence:CCGGGTTATGAACATCGTCTCCTATCTCGAGATAGGAGACGATGTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018982.3-491s1c1
Sequence:CCGGGATGATGAGTTACTGGGAAATCTCGAGATTTCCCAGTAACTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018982
VALIDATED
YIPF1 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143720    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018982.3-667s1c1
Sequence:CCGGGAGGTTATATATCCGCAGCAACTCGAGTTGCTGCGGATATATAACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143501    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-734s1c1
Sequence:CCGGGCCATAGCAATTAGTGGGAATCTCGAGATTCCCACTAATTGCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143500    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-1124s1c1
Sequence:CCGGGTGACAATTGTGTTGCTCCATCTCGAGATGGAGCAACACAATTGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140268    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018982.3-1549s1c1
Sequence:CCGGGCCACCACAGTCAAATGACATCTCGAGATGTCATTTGACTGTGGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139151    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018982.3-1223s1c1
Sequence:CCGGCCAAACCAAACAGTTGCTGCACTCGAGTGCAGCAACTGTTTGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018982.3-789s1c1
Sequence:CCGGCGTACCATTATGTGCCCGAATCTCGAGATTCGGGCACATAATGGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-611s1c1
Sequence:CCGGCAGGTCTTTGACAGAATTAAACTCGAGTTTAATTCTGTCAAAGACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145307    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-1592s1c1
Sequence:CCGGCCTGAAATAGAACCATGGAAACTCGAGTTTCCATGGTTCTATTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144885    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_018982.3-905s1c1
Sequence:CCGGGTTATGAACATCGTCTCCTATCTCGAGATAGGAGACGATGTTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144731    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_018982.3-491s1c1
Sequence:CCGGGATGATGAGTTACTGGGAAATCTCGAGATTTCCCAGTAACTCATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145550
YIPF1 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-798s1c1
Sequence:CCGGCTCTGTGTTGGTAATGACATTCTCGAGAATGTCATTACCAACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-354s1c1
Sequence:CCGGCCAGGTCTTTGACAGAATAAACTCGAGTTTATTCTGTCAAAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-797s1c1
Sequence:CCGGGCTCTGTGTTGGTAATGACATCTCGAGATGTCATTACCAACACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-127s1c1
Sequence:CCGGGCCACACTGTTAGCAGCAAATCTCGAGATTTGCTGCTAACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145550.1-1073s1c1
Sequence:CCGGCACAGCATCCACTACTGGAATCTCGAGATTCCAGTAGTGGATGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145550
YIPF1 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-798s1c1
Sequence:CCGGCTCTGTGTTGGTAATGACATTCTCGAGAATGTCATTACCAACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-354s1c1
Sequence:CCGGCCAGGTCTTTGACAGAATAAACTCGAGTTTATTCTGTCAAAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-797s1c1
Sequence:CCGGGCTCTGTGTTGGTAATGACATCTCGAGATGTCATTACCAACACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-127s1c1
Sequence:CCGGGCCACACTGTTAGCAGCAAATCTCGAGATTTGCTGCTAACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145550.1-1073s1c1
Sequence:CCGGCACAGCATCCACTACTGGAATCTCGAGATTCCAGTAGTGGATGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145550
YIPF1 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-798s1c1
Sequence:CCGGCTCTGTGTTGGTAATGACATTCTCGAGAATGTCATTACCAACACAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-354s1c1
Sequence:CCGGCCAGGTCTTTGACAGAATAAACTCGAGTTTATTCTGTCAAAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126346    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-797s1c1
Sequence:CCGGGCTCTGTGTTGGTAATGACATCTCGAGATGTCATTACCAACACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145550.1-127s1c1
Sequence:CCGGGCCACACTGTTAGCAGCAAATCTCGAGATTTGCTGCTAACAGTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126344    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145550.1-1073s1c1
Sequence:CCGGCACAGCATCCACTACTGGAATCTCGAGATTCCAGTAGTGGATGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks