EMAIL THIS PAGE TO A FRIEND

YIPF2

Yip1 domain family, member 2

Synonyms: FinGER2
UniProtKB ID: Q9BWQ6
Gene ID:
Mouse(74766) Yip1 domain family, member 2
Rat(363027) Yip1 domain family, member 2
naked mole-rat(101699435) Yip1 domain family, member 2
domestic guinea pig(100723963) Yip1 domain family, member 2
cow(515893) Yip1 domain family, member 2
sheep(101116047) Yip1 domain family, member 2
Zebrafish(445106) Yip1 domain family, member 2
domestic cat(101101290) Yip1 domain family, member 2
dog(484946) Yip1 domain family, member 2
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108420 Anti-YIPF2 antibody produced in rabbit affinity isolated antibody rabbit, horse, guinea pig, human
western blot pricing
HPA019902 Anti-YIPF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024029 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024029 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024029 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138303 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138303 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138303 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024029 Rosetta Predictions human pricing
NM_001014208 Rosetta Predictions rat pricing
NM_138303 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024029 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033259 predicted 727
2 SASI_Hs01_00033260 predicted 1158
3 SASI_Hs01_00033261 predicted 1151
4 SASI_Hs01_00033262 predicted 738
5 SASI_Hs01_00033263 predicted 1152
6 SASI_Hs01_00033264 predicted 837
7 SASI_Hs01_00033265 predicted 1228
8 SASI_Hs01_00033266 predicted 615
9 SASI_Hs01_00033267 predicted 1154
10 SASI_Hs01_00033268 predicted 736
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014208 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00062745 predicted 215
2 SASI_Rn01_00062746 predicted 593
3 SASI_Rn01_00062747 predicted 1088
4 SASI_Rn02_00201737 predicted 918
5 SASI_Rn01_00062748 predicted 1028
6 SASI_Rn01_00062749 predicted 195
7 SASI_Rn01_00062750 predicted 581
8 SASI_Rn01_00062752 predicted 1225
9 SASI_Rn02_00201738 predicted 420
10 SASI_Rn01_00062753 predicted 1065
11 SASI_Rn01_00062751 predicted 1143
12 SASI_Rn01_00062754 predicted 1436
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138303 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00339594 predicted 363
2 SASI_Mm01_00037665 predicted 576
3 SASI_Mm01_00037666 predicted 401
4 SASI_Mm01_00037667 predicted 260
5 SASI_Mm01_00037669 predicted 225
6 SASI_Mm01_00037671 predicted 1251
7 SASI_Mm02_00339595 predicted 1123
8 SASI_Mm01_00037673 predicted 500
9 SASI_Mm02_00339596 predicted 1151
10 SASI_Mm02_00339597 predicted 814
11 SASI_Mm01_00037664 predicted 1002
12 SASI_Mm01_00037668 predicted 1452
13 SASI_Mm01_00037670 predicted 1565
14 SASI_Mm01_00037672 predicted 1540
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024029
YIPF2 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 2
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024029.3-1230s1c1
Sequence:CCGGGCAAAGGTGATTCAGAGAATTCTCGAGAATTCTCTGAATCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-368s1c1
Sequence:CCGGAGCTACTATCAGAGCTTCTTTCTCGAGAAAGAAGCTCTGATAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-949s1c1
Sequence:CCGGCATGGGCTGTAAGTTGTACTTCTCGAGAAGTACAACTTACAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-158s1c1
Sequence:CCGGGAATTCGAGGAGGCCACTAATCTCGAGATTAGTGGCCTCCTCGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-364s1c1
Sequence:CCGGCTTCAGCTACTATCAGAGCTTCTCGAGAAGCTCTGATAGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024029
YIPF2 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 2
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024029.3-1230s1c1
Sequence:CCGGGCAAAGGTGATTCAGAGAATTCTCGAGAATTCTCTGAATCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-368s1c1
Sequence:CCGGAGCTACTATCAGAGCTTCTTTCTCGAGAAAGAAGCTCTGATAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-949s1c1
Sequence:CCGGCATGGGCTGTAAGTTGTACTTCTCGAGAAGTACAACTTACAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-158s1c1
Sequence:CCGGGAATTCGAGGAGGCCACTAATCTCGAGATTAGTGGCCTCCTCGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-364s1c1
Sequence:CCGGCTTCAGCTACTATCAGAGCTTCTCGAGAAGCTCTGATAGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024029
YIPF2 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 2
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115902    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024029.3-1230s1c1
Sequence:CCGGGCAAAGGTGATTCAGAGAATTCTCGAGAATTCTCTGAATCACCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-368s1c1
Sequence:CCGGAGCTACTATCAGAGCTTCTTTCTCGAGAAAGAAGCTCTGATAGTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-949s1c1
Sequence:CCGGCATGGGCTGTAAGTTGTACTTCTCGAGAAGTACAACTTACAGCCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-158s1c1
Sequence:CCGGGAATTCGAGGAGGCCACTAATCTCGAGATTAGTGGCCTCCTCGAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024029.3-364s1c1
Sequence:CCGGCTTCAGCTACTATCAGAGCTTCTCGAGAAGCTCTGATAGTAGCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138303
VALIDATED
YIPF2 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-399s21c1
Sequence:CCGGCAGCCCAGATTCTGGACATTTCTCGAGAAATGTCCAGAATCTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-526s21c1
Sequence:CCGGGAAACCGTCCCGACCTATATGCTCGAGCATATAGGTCGGGACGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-1135s21c1
Sequence:CCGGCATAGGTGAGGGACCAGTTTCCTCGAGGAAACTGGTCCCTCACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-793s21c1
Sequence:CCGGTCTACGGCTACTCACTCTTTGCTCGAGCAAAGAGTGAGTAGCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-588s21c1
Sequence:CCGGGTTACTGGCAATCTCACTTTGCTCGAGCAAAGTGAGATTGCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138303
VALIDATED
YIPF2 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-399s21c1
Sequence:CCGGCAGCCCAGATTCTGGACATTTCTCGAGAAATGTCCAGAATCTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-526s21c1
Sequence:CCGGGAAACCGTCCCGACCTATATGCTCGAGCATATAGGTCGGGACGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-1135s21c1
Sequence:CCGGCATAGGTGAGGGACCAGTTTCCTCGAGGAAACTGGTCCCTCACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-793s21c1
Sequence:CCGGTCTACGGCTACTCACTCTTTGCTCGAGCAAAGAGTGAGTAGCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-588s21c1
Sequence:CCGGGTTACTGGCAATCTCACTTTGCTCGAGCAAAGTGAGATTGCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138303
VALIDATED
YIPF2 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246544    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-399s21c1
Sequence:CCGGCAGCCCAGATTCTGGACATTTCTCGAGAAATGTCCAGAATCTGGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-526s21c1
Sequence:CCGGGAAACCGTCCCGACCTATATGCTCGAGCATATAGGTCGGGACGGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246545    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-1135s21c1
Sequence:CCGGCATAGGTGAGGGACCAGTTTCCTCGAGGAAACTGGTCCCTCACCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-793s21c1
Sequence:CCGGTCTACGGCTACTCACTCTTTGCTCGAGCAAAGAGTGAGTAGCCGTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246543    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_138303.1-588s21c1
Sequence:CCGGGTTACTGGCAATCTCACTTTGCTCGAGCAAAGTGAGATTGCCAGTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks