EMAIL THIS PAGE TO A FRIEND

YIPF3

Yip1 domain family, member 3

Synonyms: C6orf109 FinGER3 KLIP1 dJ337H4.3
UniProtKB ID: Q9GZM5, Q5JTD2, Q6FI85, Q8NI57, Q9NWE3, Q9Y3U9
Gene ID:
Mouse(28064) Yip1 domain family, member 3
Rat(301245) Yip1 domain family, member 3
Zebrafish(334511) Yip1 domain family, member 3
dog(481817) Yip1 domain family, member 3
domestic cat(101087742) Yip1 domain family, member 3
chicken(421453) Yip1 domain family, member 3
cow(540431) Yip1 domain family, member 3
sheep(101114564) Yip1 domain family, member 3
domestic guinea pig(100732958) Yip1 domain family, member 3
naked mole-rat(101710914) Yip1 domain family, member 3
72 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145353 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145353 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145353 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015388 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU039131 MISSION® esiRNA esiRNA human YIPF3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015388 Rosetta Predictions human pricing
NM_001007801 Rosetta Predictions rat pricing
NM_145353 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00086740 predicted 833
2 SASI_Hs01_00086741 predicted 668
3 SASI_Hs01_00086742 predicted 634
4 SASI_Hs01_00086744 predicted 435
5 SASI_Hs01_00086745 predicted 477
6 SASI_Hs01_00086746 predicted 896
7 SASI_Hs01_00086747 predicted 1181
8 SASI_Hs01_00086748 predicted 613
9 SASI_Hs01_00086749 predicted 825
10 SASI_Hs01_00086743 predicted 1157
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007801 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058488 predicted 415
2 SASI_Rn02_00198960 predicted 1410
3 SASI_Rn01_00058489 predicted 404
4 SASI_Rn01_00058490 predicted 407
5 SASI_Rn01_00058491 predicted 1582
6 SASI_Rn01_00058492 predicted 333
7 SASI_Rn01_00058494 predicted 721
8 SASI_Rn01_00058495 predicted 602
9 SASI_Rn01_00058496 predicted 215
10 SASI_Rn01_00058497 predicted 212
11 SASI_Rn01_00058493 predicted 1315
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145353 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00340612 predicted 459
2 SASI_Mm01_00059806 predicted 1164
3 SASI_Mm01_00059807 predicted 763
4 SASI_Mm02_00340613 predicted 462
5 SASI_Mm01_00059808 predicted 649
6 SASI_Mm01_00059809 predicted 990
7 SASI_Mm01_00059811 predicted 278
8 SASI_Mm01_00059812 predicted 772
9 SASI_Mm01_00059813 predicted 284
10 SASI_Mm01_00059814 predicted 1007
11 SASI_Mm01_00059810 predicted 739
12 SASI_Mm01_00059815 predicted 378
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145353
VALIDATED
YIPF3 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000340941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-1259s21c1
Sequence:CCGGGAGGAAGATTAAAGGACAGTACTCGAGTACTGTCCTTTAATCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-853s21c1
Sequence:CCGGGTCCTGTTCATCACCTATAACCTCGAGGTTATAGGTGATGAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-570s21c1
Sequence:CCGGGATCCCTATCAAGATGGTCAACTCGAGTTGACCATCTTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000340864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-271s21c1
Sequence:CCGGGATATGGAGAACATGGACGATCTCGAGATCGTCCATGTTCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-776s1c1
Sequence:CCGGGATCACCATGCTACAGATGTTCTCGAGAACATCTGTAGCATGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-551s1c1
Sequence:CCGGGATCCCTATCAAGATGGTCAACTCGAGTTGACCATCTTGATAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-252s1c1
Sequence:CCGGGATATGGAGAACATGGACGATCTCGAGATCGTCCATGTTCTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145353.1-1237s1c1
Sequence:CCGGGCAGAGGAAGATTAAAGGACACTCGAGTGTCCTTTAATCTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145353.1-1240s1c1
Sequence:CCGGGAGGAAGATTAAAGGACAGTACTCGAGTACTGTCCTTTAATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145353.1-554s1c1
Sequence:CCGGCCCTATCAAGATGGTCAACTTCTCGAGAAGTTGACCATCTTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145353
VALIDATED
YIPF3 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000340941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-1259s21c1
Sequence:CCGGGAGGAAGATTAAAGGACAGTACTCGAGTACTGTCCTTTAATCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-853s21c1
Sequence:CCGGGTCCTGTTCATCACCTATAACCTCGAGGTTATAGGTGATGAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-570s21c1
Sequence:CCGGGATCCCTATCAAGATGGTCAACTCGAGTTGACCATCTTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000340864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-271s21c1
Sequence:CCGGGATATGGAGAACATGGACGATCTCGAGATCGTCCATGTTCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-776s1c1
Sequence:CCGGGATCACCATGCTACAGATGTTCTCGAGAACATCTGTAGCATGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-551s1c1
Sequence:CCGGGATCCCTATCAAGATGGTCAACTCGAGTTGACCATCTTGATAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-252s1c1
Sequence:CCGGGATATGGAGAACATGGACGATCTCGAGATCGTCCATGTTCTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145353.1-1237s1c1
Sequence:CCGGGCAGAGGAAGATTAAAGGACACTCGAGTGTCCTTTAATCTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145353.1-1240s1c1
Sequence:CCGGGAGGAAGATTAAAGGACAGTACTCGAGTACTGTCCTTTAATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145353.1-554s1c1
Sequence:CCGGCCCTATCAAGATGGTCAACTTCTCGAGAAGTTGACCATCTTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145353
VALIDATED
YIPF3 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000340941    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-1259s21c1
Sequence:CCGGGAGGAAGATTAAAGGACAGTACTCGAGTACTGTCCTTTAATCTTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-853s21c1
Sequence:CCGGGTCCTGTTCATCACCTATAACCTCGAGGTTATAGGTGATGAACAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-570s21c1
Sequence:CCGGGATCCCTATCAAGATGGTCAACTCGAGTTGACCATCTTGATAGGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000340864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_145353.2-271s21c1
Sequence:CCGGGATATGGAGAACATGGACGATCTCGAGATCGTCCATGTTCTCCATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-776s1c1
Sequence:CCGGGATCACCATGCTACAGATGTTCTCGAGAACATCTGTAGCATGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175930    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-551s1c1
Sequence:CCGGGATCCCTATCAAGATGGTCAACTCGAGTTGACCATCTTGATAGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145353.1-252s1c1
Sequence:CCGGGATATGGAGAACATGGACGATCTCGAGATCGTCCATGTTCTCCATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193986    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_145353.1-1237s1c1
Sequence:CCGGGCAGAGGAAGATTAAAGGACACTCGAGTGTCCTTTAATCTTCCTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193457    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145353.1-1240s1c1
Sequence:CCGGGAGGAAGATTAAAGGACAGTACTCGAGTACTGTCCTTTAATCTTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145353.1-554s1c1
Sequence:CCGGCCCTATCAAGATGGTCAACTTCTCGAGAAGTTGACCATCTTGATAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015388
YIPF3 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 3
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000243224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-853s21c1
Sequence:CCGGCCTGTTCATCACCTATAATATCTCGAGATATTATAGGTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015388.2-1253s21c1
Sequence:CCGGAGAGAGGAGGAAGACTATTAACTCGAGTTAATAGTCTTCCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-745s21c1
Sequence:CCGGGGGAGTCTCATCCTTCATTTACTCGAGTAAATGAAGGATGAGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-669s21c1
Sequence:CCGGTGAAGACGTCTGACACTATTACTCGAGTAATAGTGTCAGACGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000243223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-286s21c1
Sequence:CCGGAGGCTCTAGCTTCGAGGATATCTCGAGATATCCTCGAAGCTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015388.1-571s1c1
Sequence:CCGGGTGAACTCTATGGACCTCTCACTCGAGTGAGAGGTCCATAGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015388
YIPF3 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 3
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000243224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-853s21c1
Sequence:CCGGCCTGTTCATCACCTATAATATCTCGAGATATTATAGGTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015388.2-1253s21c1
Sequence:CCGGAGAGAGGAGGAAGACTATTAACTCGAGTTAATAGTCTTCCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-745s21c1
Sequence:CCGGGGGAGTCTCATCCTTCATTTACTCGAGTAAATGAAGGATGAGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-669s21c1
Sequence:CCGGTGAAGACGTCTGACACTATTACTCGAGTAATAGTGTCAGACGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000243223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-286s21c1
Sequence:CCGGAGGCTCTAGCTTCGAGGATATCTCGAGATATCCTCGAAGCTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015388.1-571s1c1
Sequence:CCGGGTGAACTCTATGGACCTCTCACTCGAGTGAGAGGTCCATAGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015388
YIPF3 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 3
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000243224    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-853s21c1
Sequence:CCGGCCTGTTCATCACCTATAATATCTCGAGATATTATAGGTGATGAACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015388.2-1253s21c1
Sequence:CCGGAGAGAGGAGGAAGACTATTAACTCGAGTTAATAGTCTTCCTCCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-745s21c1
Sequence:CCGGGGGAGTCTCATCCTTCATTTACTCGAGTAAATGAAGGATGAGACTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-669s21c1
Sequence:CCGGTGAAGACGTCTGACACTATTACTCGAGTAATAGTGTCAGACGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000243223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015388.2-286s21c1
Sequence:CCGGAGGCTCTAGCTTCGAGGATATCTCGAGATATCCTCGAAGCTAGAGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172548    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015388.1-571s1c1
Sequence:CCGGGTGAACTCTATGGACCTCTCACTCGAGTGAGAGGTCCATAGAGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks