EMAIL THIS PAGE TO A FRIEND

YIPF4

Yip1 domain family, member 4

Synonyms: FinGER4
UniProtKB ID: Q9BSR8
Gene ID:
Mouse(67864) Yip1 domain family, member 4
Rat(362699) Yip1 domain family, member 4
naked mole-rat(101713643) Yip1 domain family, member 4
domestic guinea pig(100732764) Yip1 domain family, member 4
cow(615287) Yip1 domain family, member 4
sheep(101103885) Yip1 domain family, member 4
Zebrafish(405827) Yip1 domain family, member 4
domestic cat(101085969) Yip1 domain family, member 4
dog(475717) Yip1 domain family, member 4
chicken(421464) Yip1 domain family, member 4
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032312 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032312 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032312 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026417 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026417 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026417 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032312 Rosetta Predictions human pricing
NM_001009712 Rosetta Predictions rat pricing
NM_026417 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013921 predicted 604
2 SASI_Hs01_00013923 predicted 763
3 SASI_Hs01_00013924 predicted 811
4 SASI_Hs01_00013925 predicted 810
5 SASI_Hs02_00359659 predicted 413
6 SASI_Hs01_00013926 predicted 264
7 SASI_Hs02_00359660 predicted 417
8 SASI_Hs01_00013927 predicted 714
9 SASI_Hs02_00359661 predicted 606
10 SASI_Hs01_00013928 predicted 270
11 SASI_Hs01_00013920 predicted 769
12 SASI_Hs01_00013922 predicted 525
13 SASI_Hs01_00013929 predicted 704
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009712 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00053454 predicted 318
2 SASI_Rn01_00053455 predicted 818
3 SASI_Rn02_00199775 predicted 241
4 SASI_Rn01_00053456 predicted 612
5 SASI_Rn01_00053457 predicted 695
6 SASI_Rn01_00053458 predicted 875
7 SASI_Rn01_00053460 predicted 771
8 SASI_Rn01_00053461 predicted 720
9 SASI_Rn01_00053462 predicted 454
10 SASI_Rn01_00053463 predicted 704
11 SASI_Rn01_00053459 predicted 634
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026417 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00125274 predicted 353
2 SASI_Mm02_00330223 predicted 617
3 SASI_Mm02_00330224 predicted 774
4 SASI_Mm01_00125275 predicted 697
5 SASI_Mm02_00330225 predicted 324
6 SASI_Mm01_00125276 predicted 819
7 SASI_Mm01_00125277 predicted 728
8 SASI_Mm01_00125279 predicted 633
9 SASI_Mm01_00125280 predicted 603
10 SASI_Mm01_00125282 predicted 347
11 SASI_Mm01_00125278 predicted 710
12 SASI_Mm01_00125281 predicted 839
13 SASI_Mm01_00125283 predicted 446
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032312
VALIDATED
YIPF4 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-1326s1c1
Sequence:CCGGGCATCACAGATCCTGCAGATACTCGAGTATCTGCAGGATCTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-1230s1c1
Sequence:CCGGGCACCTGGATTGGTAATTATACTCGAGTATAATTACCAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032312.2-352s1c1
Sequence:CCGGCATTTCTGAGACAAAGAGGTTCTCGAGAACCTCTTTGTCTCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-268s1c1
Sequence:CCGGCGGAAGATCTCAGTGGTTCAACTCGAGTTGAACCACTGAGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032312.2-825s1c1
Sequence:CCGGGCTTCATTGTTAGTGGGTGAACTCGAGTTCACCCACTAACAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-666s1c1
Sequence:CCGGCTTGGTGGAGAAGTTGCATATCTCGAGATATGCAACTTCTCCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-470s21c1
Sequence:CCGGATGATGATCCTGAAGATAACACTCGAGTGTTATCTTCAGGATCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-696s21c1
Sequence:CCGGTTGGATATTTGGTTCACTAACCTCGAGGTTAGTGAACCAAATATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-761s21c1
Sequence:CCGGGCCAAGTCCTTGGAGTTATAGCTCGAGCTATAACTCCAAGGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-671s21c1
Sequence:CCGGGGGTGGTCTCATGGATTATAACTCGAGTTATAATCCATGAGACCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032312
VALIDATED
YIPF4 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-1326s1c1
Sequence:CCGGGCATCACAGATCCTGCAGATACTCGAGTATCTGCAGGATCTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-1230s1c1
Sequence:CCGGGCACCTGGATTGGTAATTATACTCGAGTATAATTACCAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032312.2-352s1c1
Sequence:CCGGCATTTCTGAGACAAAGAGGTTCTCGAGAACCTCTTTGTCTCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-268s1c1
Sequence:CCGGCGGAAGATCTCAGTGGTTCAACTCGAGTTGAACCACTGAGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032312.2-825s1c1
Sequence:CCGGGCTTCATTGTTAGTGGGTGAACTCGAGTTCACCCACTAACAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-666s1c1
Sequence:CCGGCTTGGTGGAGAAGTTGCATATCTCGAGATATGCAACTTCTCCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-470s21c1
Sequence:CCGGATGATGATCCTGAAGATAACACTCGAGTGTTATCTTCAGGATCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-696s21c1
Sequence:CCGGTTGGATATTTGGTTCACTAACCTCGAGGTTAGTGAACCAAATATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-761s21c1
Sequence:CCGGGCCAAGTCCTTGGAGTTATAGCTCGAGCTATAACTCCAAGGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-671s21c1
Sequence:CCGGGGGTGGTCTCATGGATTATAACTCGAGTTATAATCCATGAGACCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032312
VALIDATED
YIPF4 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129527    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-1326s1c1
Sequence:CCGGGCATCACAGATCCTGCAGATACTCGAGTATCTGCAGGATCTGTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-1230s1c1
Sequence:CCGGGCACCTGGATTGGTAATTATACTCGAGTATAATTACCAATCCAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128654    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032312.2-352s1c1
Sequence:CCGGCATTTCTGAGACAAAGAGGTTCTCGAGAACCTCTTTGTCTCAGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-268s1c1
Sequence:CCGGCGGAAGATCTCAGTGGTTCAACTCGAGTTGAACCACTGAGATCTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149038    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032312.2-825s1c1
Sequence:CCGGGCTTCATTGTTAGTGGGTGAACTCGAGTTCACCCACTAACAATGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148843    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_032312.2-666s1c1
Sequence:CCGGCTTGGTGGAGAAGTTGCATATCTCGAGATATGCAACTTCTCCACCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427053    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-470s21c1
Sequence:CCGGATGATGATCCTGAAGATAACACTCGAGTGTTATCTTCAGGATCATCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426060    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-696s21c1
Sequence:CCGGTTGGATATTTGGTTCACTAACCTCGAGGTTAGTGAACCAAATATCCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420687    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-761s21c1
Sequence:CCGGGCCAAGTCCTTGGAGTTATAGCTCGAGCTATAACTCCAAGGACTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425311    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032312.3-671s21c1
Sequence:CCGGGGGTGGTCTCATGGATTATAACTCGAGTTATAATCCATGAGACCACCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026417
VALIDATED
YIPF4 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-641s1c1
Sequence:CCGGGATATTTGGTTCACTGACAATCTCGAGATTGTCAGTGAACCAAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-837s1c1
Sequence:CCGGGCTGCTTCATTACTCGTAGGTCTCGAGACCTACGAGTAATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-840s1c1
Sequence:CCGGGCTTCATTACTCGTAGGTGAACTCGAGTTCACCTACGAGTAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026417.2-360s1c1
Sequence:CCGGGCTACTACATTTCTGAGACAACTCGAGTTGTCTCAGAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-1344s1c1
Sequence:CCGGGCACCACAGATCCTGTAGATACTCGAGTATCTACAGGATCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-322s21c1
Sequence:CCGGCCTCGGTGTAAGCGGAGATTTCTCGAGAAATCTCCGCTTACACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026417.3-1166s21c1
Sequence:CCGGTCTTCATATTCCGCGAATAAACTCGAGTTTATTCGCGGAATATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-836s21c1
Sequence:CCGGGCTGCTTCATTACTCGTAGGTCTCGAGACCTACGAGTAATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-359s21c1
Sequence:CCGGGCTACTACATTTCTGAGACAACTCGAGTTGTCTCAGAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-640s21c1
Sequence:CCGGGATATTTGGTTCACTGACAATCTCGAGATTGTCAGTGAACCAAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026417
VALIDATED
YIPF4 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-641s1c1
Sequence:CCGGGATATTTGGTTCACTGACAATCTCGAGATTGTCAGTGAACCAAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-837s1c1
Sequence:CCGGGCTGCTTCATTACTCGTAGGTCTCGAGACCTACGAGTAATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-840s1c1
Sequence:CCGGGCTTCATTACTCGTAGGTGAACTCGAGTTCACCTACGAGTAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026417.2-360s1c1
Sequence:CCGGGCTACTACATTTCTGAGACAACTCGAGTTGTCTCAGAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-1344s1c1
Sequence:CCGGGCACCACAGATCCTGTAGATACTCGAGTATCTACAGGATCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-322s21c1
Sequence:CCGGCCTCGGTGTAAGCGGAGATTTCTCGAGAAATCTCCGCTTACACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026417.3-1166s21c1
Sequence:CCGGTCTTCATATTCCGCGAATAAACTCGAGTTTATTCGCGGAATATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-836s21c1
Sequence:CCGGGCTGCTTCATTACTCGTAGGTCTCGAGACCTACGAGTAATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-359s21c1
Sequence:CCGGGCTACTACATTTCTGAGACAACTCGAGTTGTCTCAGAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-640s21c1
Sequence:CCGGGATATTTGGTTCACTGACAATCTCGAGATTGTCAGTGAACCAAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026417
VALIDATED
YIPF4 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123888    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-641s1c1
Sequence:CCGGGATATTTGGTTCACTGACAATCTCGAGATTGTCAGTGAACCAAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123887    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-837s1c1
Sequence:CCGGGCTGCTTCATTACTCGTAGGTCTCGAGACCTACGAGTAATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123886    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-840s1c1
Sequence:CCGGGCTTCATTACTCGTAGGTGAACTCGAGTTCACCTACGAGTAATGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026417.2-360s1c1
Sequence:CCGGGCTACTACATTTCTGAGACAACTCGAGTTGTCTCAGAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123884    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026417.2-1344s1c1
Sequence:CCGGGCACCACAGATCCTGTAGATACTCGAGTATCTACAGGATCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306344    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-322s21c1
Sequence:CCGGCCTCGGTGTAAGCGGAGATTTCTCGAGAAATCTCCGCTTACACCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311504    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026417.3-1166s21c1
Sequence:CCGGTCTTCATATTCCGCGAATAAACTCGAGTTTATTCGCGGAATATGAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-836s21c1
Sequence:CCGGGCTGCTTCATTACTCGTAGGTCTCGAGACCTACGAGTAATGAAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326712    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-359s21c1
Sequence:CCGGGCTACTACATTTCTGAGACAACTCGAGTTGTCTCAGAAATGTAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026417.3-640s21c1
Sequence:CCGGGATATTTGGTTCACTGACAATCTCGAGATTGTCAGTGAACCAAATATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks