EMAIL THIS PAGE TO A FRIEND

YIPF5

Yip1 domain family, member 5

Synonyms: FinGER5 SB140 SMAP-5 SMAP5 YIP1A
Gene ID:
Mouse(67180) Yip1 domain family, member 5
Rat(361315) Yip1 domain family, member 5
Zebrafish(393265) Yip1 domain family, member 5
chicken(416344) Yip1 domain family, member 5
domestic cat(101081359) Yip1 domain family, member 5
dog(478048) Yip1 domain family, member 5
cow(521829) Yip1 domain family, member 5
sheep(101110588) Yip1 domain family, member 5
domestic guinea pig(100731326) Yip1 domain family, member 5
naked mole-rat(101724566) Yip1 domain family, member 5
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030799 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023311 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023311 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023311 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU042061 MISSION® esiRNA esiRNA human YIPF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001024947 Rosetta Predictions human pricing
NM_030799 Rosetta Predictions human pricing
NM_001014150 Rosetta Predictions rat pricing
NM_023311 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024947 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00307278 predicted 651
2 SASI_Hs02_00307279 predicted 1302
3 SASI_Hs02_00307280 predicted 945
4 SASI_Hs02_00307281 predicted 753
5 SASI_Hs02_00307282 predicted 990
6 SASI_Hs02_00307283 predicted 678
7 SASI_Hs02_00307284 predicted 1156
8 SASI_Hs02_00307285 predicted 856
9 SASI_Hs02_00307286 predicted 804
10 SASI_Hs02_00307287 predicted 901
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00039141 predicted 396
2 SASI_Hs01_00039142 predicted 1046
3 SASI_Hs01_00039143 predicted 699
4 SASI_Hs01_00039144 predicted 504
5 SASI_Hs01_00039145 predicted 738
6 SASI_Hs02_00358359 predicted 428
7 SASI_Hs02_00358360 predicted 905
8 SASI_Hs01_00039147 predicted 601
9 SASI_Hs01_00039148 predicted 553
10 SASI_Hs01_00039149 predicted 650
11 SASI_Hs01_00039146 predicted 219
12 SASI_Hs01_00039150 predicted 374
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001014150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00201617 predicted 964
2 SASI_Rn02_00201618 predicted 1142
3 SASI_Rn02_00201619 predicted 1151
4 SASI_Rn02_00201620 predicted 957
5 SASI_Rn02_00201621 predicted 1118
6 SASI_Rn02_00201622 predicted 1071
7 SASI_Rn02_00201623 predicted 892
8 SASI_Rn02_00201624 predicted 1118
9 SASI_Rn02_00201625 predicted 242
10 SASI_Rn02_00201626 predicted 776
11 SASI_Rn01_00116749 predicted 928
12 SASI_Rn01_00116750 predicted 1273
13 SASI_Rn01_00116751 predicted 1776
14 SASI_Rn01_00116752 predicted 1205
15 SASI_Rn01_00116753 predicted 1078
16 SASI_Rn01_00116754 predicted 746
17 SASI_Rn01_00116755 predicted 430
18 SASI_Rn01_00116756 predicted 547
19 SASI_Rn01_00116757 predicted 379
20 SASI_Rn01_00116758 predicted 683
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023311 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058063 predicted 730
2 SASI_Mm02_00327035 predicted 592
3 SASI_Mm02_00327036 predicted 735
4 SASI_Mm01_00058069 predicted 818
5 SASI_Mm01_00058071 predicted 806
6 SASI_Mm01_00058072 predicted 871
7 SASI_Mm02_00327037 predicted 458
8 SASI_Mm02_00327038 predicted 761
9 SASI_Mm02_00327039 predicted 402
10 SASI_Mm01_00058064 predicted 1168
11 SASI_Mm01_00058065 predicted 1152
12 SASI_Mm01_00058066 predicted 1144
13 SASI_Mm01_00058067 predicted 452
14 SASI_Mm01_00058068 predicted 1199
15 SASI_Mm01_00058070 predicted 973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030799
VALIDATED
YIPF5 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000338631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-1086s21c1
Sequence:CCGGGCAATGAAAGTAAACGTGTATCTCGAGATACACGTTTACTTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-730s21c1
Sequence:CCGGGGCAAGTGTCCTTGGATATTGCTCGAGCAATATCCAAGGACACTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-391s21c1
Sequence:CCGGCCAGCCAACTCAGGCATATACCTCGAGGTATATGCCTGAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-303s21c1
Sequence:CCGGAGTATGCTGGCTATGACTATTCTCGAGAATAGTCATAGCCAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-468s21c1
Sequence:CCGGTAGAAGAGTTAGGTATCAATTCTCGAGAATTGATACCTAACTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-584s1c1
Sequence:CCGGGAGTATGACAGGTGTTTCATTCTCGAGAATGAAACACCTGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-806s1c1
Sequence:CCGGCGCTTTGTTATATGGAGTCTTCTCGAGAAGACTCCATATAACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-342s1c1
Sequence:CCGGCCACCTTTATTAGAAGAGTTACTCGAGTAACTCTTCTAATAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-1761s1c1
Sequence:CCGGGCGAACACTTACTTACATATTCTCGAGAATATGTAAGTAAGTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-433s1c1
Sequence:CCGGGCATCATGAATGAAACTGATTCTCGAGAATCAGTTTCATTCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-946s1c1
Sequence:CCGGGCAGATTTACATTTGACTGTTCTCGAGAACAGTCAAATGTAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030799.5-970s1c1
Sequence:CCGGGCAATGAAAGTAAACGTGTATCTCGAGATACACGTTTACTTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-796s1c1
Sequence:CCGGCATATCCTTGCGCTTTGTTATCTCGAGATAACAAAGCGCAAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030799
VALIDATED
YIPF5 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000338631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-1086s21c1
Sequence:CCGGGCAATGAAAGTAAACGTGTATCTCGAGATACACGTTTACTTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-730s21c1
Sequence:CCGGGGCAAGTGTCCTTGGATATTGCTCGAGCAATATCCAAGGACACTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-391s21c1
Sequence:CCGGCCAGCCAACTCAGGCATATACCTCGAGGTATATGCCTGAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-303s21c1
Sequence:CCGGAGTATGCTGGCTATGACTATTCTCGAGAATAGTCATAGCCAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-468s21c1
Sequence:CCGGTAGAAGAGTTAGGTATCAATTCTCGAGAATTGATACCTAACTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-584s1c1
Sequence:CCGGGAGTATGACAGGTGTTTCATTCTCGAGAATGAAACACCTGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-806s1c1
Sequence:CCGGCGCTTTGTTATATGGAGTCTTCTCGAGAAGACTCCATATAACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-342s1c1
Sequence:CCGGCCACCTTTATTAGAAGAGTTACTCGAGTAACTCTTCTAATAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-1761s1c1
Sequence:CCGGGCGAACACTTACTTACATATTCTCGAGAATATGTAAGTAAGTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-433s1c1
Sequence:CCGGGCATCATGAATGAAACTGATTCTCGAGAATCAGTTTCATTCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-946s1c1
Sequence:CCGGGCAGATTTACATTTGACTGTTCTCGAGAACAGTCAAATGTAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030799.5-970s1c1
Sequence:CCGGGCAATGAAAGTAAACGTGTATCTCGAGATACACGTTTACTTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-796s1c1
Sequence:CCGGCATATCCTTGCGCTTTGTTATCTCGAGATAACAAAGCGCAAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030799
VALIDATED
YIPF5 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000338631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-1086s21c1
Sequence:CCGGGCAATGAAAGTAAACGTGTATCTCGAGATACACGTTTACTTTCATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338632    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-730s21c1
Sequence:CCGGGGCAAGTGTCCTTGGATATTGCTCGAGCAATATCCAAGGACACTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338634    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-391s21c1
Sequence:CCGGCCAGCCAACTCAGGCATATACCTCGAGGTATATGCCTGAGTTGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-303s21c1
Sequence:CCGGAGTATGCTGGCTATGACTATTCTCGAGAATAGTCATAGCCAGCATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338633    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_030799.7-468s21c1
Sequence:CCGGTAGAAGAGTTAGGTATCAATTCTCGAGAATTGATACCTAACTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168737    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-584s1c1
Sequence:CCGGGAGTATGACAGGTGTTTCATTCTCGAGAATGAAACACCTGTCATACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-806s1c1
Sequence:CCGGCGCTTTGTTATATGGAGTCTTCTCGAGAAGACTCCATATAACAAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167293    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-342s1c1
Sequence:CCGGCCACCTTTATTAGAAGAGTTACTCGAGTAACTCTTCTAATAAAGGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167530    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-1761s1c1
Sequence:CCGGGCGAACACTTACTTACATATTCTCGAGAATATGTAAGTAAGTGTTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-433s1c1
Sequence:CCGGGCATCATGAATGAAACTGATTCTCGAGAATCAGTTTCATTCATGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_030799.5-946s1c1
Sequence:CCGGGCAGATTTACATTTGACTGTTCTCGAGAACAGTCAAATGTAAATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167854    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_030799.5-970s1c1
Sequence:CCGGGCAATGAAAGTAAACGTGTATCTCGAGATACACGTTTACTTTCATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168049    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030799.5-796s1c1
Sequence:CCGGCATATCCTTGCGCTTTGTTATCTCGAGATAACAAAGCGCAAGGATATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023311
YIPF5 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 5
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000308559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-820s21c1
Sequence:CCGGCCACAATTATTGGATGGTGTACTCGAGTACACCATCCAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023311.3-1757s21c1
Sequence:CCGGCCCAATTAACTCTGCTGTGAACTCGAGTTCACAGCAGAGTTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-653s21c1
Sequence:CCGGGATTGGATGTTTAGGAATGTTCTCGAGAACATTCCTAAACATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000308560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-915s21c1
Sequence:CCGGGCTTTGTTGTATGGAGTCTTTCTCGAGAAAGACTCCATACAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023311.3-1757s1c1
Sequence:CCGGCCCAATTAACTCTGCTGTGAACTCGAGTTCACAGCAGAGTTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-653s1c1
Sequence:CCGGGATTGGATGTTTAGGAATGTTCTCGAGAACATTCCTAAACATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-915s1c1
Sequence:CCGGGCTTTGTTGTATGGAGTCTTTCTCGAGAAAGACTCCATACAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-820s1c1
Sequence:CCGGCCACAATTATTGGATGGTGTACTCGAGTACACCATCCAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-419s1c1
Sequence:CCGGGCCATTCTATGGAGACAGCTTCTCGAGAAGCTGTCTCCATAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023311
YIPF5 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 5
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000308559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-820s21c1
Sequence:CCGGCCACAATTATTGGATGGTGTACTCGAGTACACCATCCAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023311.3-1757s21c1
Sequence:CCGGCCCAATTAACTCTGCTGTGAACTCGAGTTCACAGCAGAGTTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-653s21c1
Sequence:CCGGGATTGGATGTTTAGGAATGTTCTCGAGAACATTCCTAAACATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000308560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-915s21c1
Sequence:CCGGGCTTTGTTGTATGGAGTCTTTCTCGAGAAAGACTCCATACAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023311.3-1757s1c1
Sequence:CCGGCCCAATTAACTCTGCTGTGAACTCGAGTTCACAGCAGAGTTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-653s1c1
Sequence:CCGGGATTGGATGTTTAGGAATGTTCTCGAGAACATTCCTAAACATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-915s1c1
Sequence:CCGGGCTTTGTTGTATGGAGTCTTTCTCGAGAAAGACTCCATACAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-820s1c1
Sequence:CCGGCCACAATTATTGGATGGTGTACTCGAGTACACCATCCAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-419s1c1
Sequence:CCGGGCCATTCTATGGAGACAGCTTCTCGAGAAGCTGTCTCCATAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023311
YIPF5 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 5
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000308559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-820s21c1
Sequence:CCGGCCACAATTATTGGATGGTGTACTCGAGTACACCATCCAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308478    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023311.3-1757s21c1
Sequence:CCGGCCCAATTAACTCTGCTGTGAACTCGAGTTCACAGCAGAGTTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308479    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-653s21c1
Sequence:CCGGGATTGGATGTTTAGGAATGTTCTCGAGAACATTCCTAAACATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000308560    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023311.3-915s21c1
Sequence:CCGGGCTTTGTTGTATGGAGTCTTTCTCGAGAAAGACTCCATACAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125919    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023311.3-1757s1c1
Sequence:CCGGCCCAATTAACTCTGCTGTGAACTCGAGTTCACAGCAGAGTTAATTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125923    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-653s1c1
Sequence:CCGGGATTGGATGTTTAGGAATGTTCTCGAGAACATTCCTAAACATCCAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125922    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-915s1c1
Sequence:CCGGGCTTTGTTGTATGGAGTCTTTCTCGAGAAAGACTCCATACAACAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125920    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-820s1c1
Sequence:CCGGCCACAATTATTGGATGGTGTACTCGAGTACACCATCCAATAATTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125921    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023311.3-419s1c1
Sequence:CCGGGCCATTCTATGGAGACAGCTTCTCGAGAAGCTGTCTCCATAGAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks