EMAIL THIS PAGE TO A FRIEND

YIPF6

Yip1 domain family, member 6

Synonyms: FinGER6
UniProtKB ID: Q96EC8, B4E1U7, G5E997, Q5JP08
Gene ID:
Mouse(77929) Yip1 domain family, member 6
Rat(363476) Yip1 domain family, member 6
domestic guinea pig(100727349) Yip1 domain family, member 6
cow(540347) Yip1 domain family, member 6
sheep(101120551) Yip1 domain family, member 6
Zebrafish(415186) Yip1 domain family, member 6
domestic cat(101082295) Yip1 domain family, member 6
chicken(422161) Yip1 domain family, member 6
dog(491931) Yip1 domain family, member 6
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA003720 Anti-YIPF6 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102734 Anti-YIPF6 antibody produced in rabbit affinity isolated antibody bovine, zebrafish, horse, mouse, rabbit, human, canine, rat, guinea pig
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173834 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173834 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173834 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_030007 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030007 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030007 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_207633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_207633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_207633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_173834 Rosetta Predictions human pricing
NM_001025747 Rosetta Predictions rat pricing
NM_207633 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173834 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00145029 predicted 755
2 SASI_Hs01_00145030 predicted 962
3 SASI_Hs01_00145031 predicted 329
4 SASI_Hs01_00145032 predicted 727
5 SASI_Hs01_00145033 predicted 317
6 SASI_Hs01_00145034 predicted 963
7 SASI_Hs01_00145035 predicted 960
8 SASI_Hs01_00145036 predicted 486
9 SASI_Hs01_00145037 predicted 199
10 SASI_Hs01_00145038 predicted 832
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025747 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00034734 predicted 759
2 SASI_Rn01_00034735 predicted 358
3 SASI_Rn01_00034736 predicted 824
4 SASI_Rn01_00034737 predicted 950
5 SASI_Rn01_00034738 predicted 451
6 SASI_Rn01_00034739 predicted 703
7 SASI_Rn01_00034741 predicted 731
8 SASI_Rn01_00034742 predicted 922
9 SASI_Rn01_00034743 predicted 408
10 SASI_Rn02_00203406 predicted 695
11 SASI_Rn01_00034740 predicted 216
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_207633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039068 predicted 814
2 SASI_Mm01_00039069 predicted 1203
3 SASI_Mm01_00039070 predicted 630
4 SASI_Mm01_00039071 predicted 658
5 SASI_Mm02_00352154 predicted 1189
6 SASI_Mm01_00039072 predicted 722
7 SASI_Mm01_00039073 predicted 839
8 SASI_Mm01_00039074 predicted 686
9 SASI_Mm01_00039075 predicted 1175
10 SASI_Mm01_00039077 predicted 1228
11 SASI_Mm01_00039076 predicted 598
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173834
VALIDATED
YIPF6 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 6
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173834.2-771s1c1
Sequence:CCGGGCACATCTGAAAGATGCAATTCTCGAGAATTGCATCTTTCAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-203s21c1
Sequence:CCGGTACCATCATGCGTGATCTAAACTCGAGTTTAGATCACGCATGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-82s21c1
Sequence:CCGGTTGCAGGCCTTTCAGATATATCTCGAGATATATCTGAAAGGCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-165s21c1
Sequence:CCGGGAGTTTGACAGCTCCACATTACTCGAGTAATGTGGAGCTGTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-802s21c1
Sequence:CCGGCTTTGTCTCTGGCCCTTATTTCTCGAGAAATAAGGGCCAGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-313s21c1
Sequence:CCGGTTTGTGTGACACTCGCATTAACTCGAGTTAATGCGAGTGTCACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173834
VALIDATED
YIPF6 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 6
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173834.2-771s1c1
Sequence:CCGGGCACATCTGAAAGATGCAATTCTCGAGAATTGCATCTTTCAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-203s21c1
Sequence:CCGGTACCATCATGCGTGATCTAAACTCGAGTTTAGATCACGCATGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-82s21c1
Sequence:CCGGTTGCAGGCCTTTCAGATATATCTCGAGATATATCTGAAAGGCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-165s21c1
Sequence:CCGGGAGTTTGACAGCTCCACATTACTCGAGTAATGTGGAGCTGTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-802s21c1
Sequence:CCGGCTTTGTCTCTGGCCCTTATTTCTCGAGAAATAAGGGCCAGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-313s21c1
Sequence:CCGGTTTGTGTGACACTCGCATTAACTCGAGTTAATGCGAGTGTCACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173834
VALIDATED
YIPF6 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 6
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168435    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_173834.2-771s1c1
Sequence:CCGGGCACATCTGAAAGATGCAATTCTCGAGAATTGCATCTTTCAGATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-203s21c1
Sequence:CCGGTACCATCATGCGTGATCTAAACTCGAGTTTAGATCACGCATGATGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-82s21c1
Sequence:CCGGTTGCAGGCCTTTCAGATATATCTCGAGATATATCTGAAAGGCCTGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242122    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-165s21c1
Sequence:CCGGGAGTTTGACAGCTCCACATTACTCGAGTAATGTGGAGCTGTCAAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242121    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-802s21c1
Sequence:CCGGCTTTGTCTCTGGCCCTTATTTCTCGAGAAATAAGGGCCAGAGACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_173834.2-313s21c1
Sequence:CCGGTTTGTGTGACACTCGCATTAACTCGAGTTAATGCGAGTGTCACACAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030007
YIPF6 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 6
Mouse
1 Products Total
TRC Number Price Set Price (1)? Select
TRCN0000184483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030007.1-846s1c1
Sequence:CCGGGCAGTTACCATCACGCTGAATCTCGAGATTCAGCGTGATGGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030007
YIPF6 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 6
Mouse
1 Products Total
TRC Number Vector Price Set Price (1)? Select
TRCN0000184483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030007.1-846s1c1
Sequence:CCGGGCAGTTACCATCACGCTGAATCTCGAGATTCAGCGTGATGGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030007
YIPF6 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 6
Mouse
1 Products Total
TRC Number Volume Titer Vector Price Set Price (1)? Select
TRCN0000184483    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_030007.1-846s1c1
Sequence:CCGGGCAGTTACCATCACGCTGAATCTCGAGATTCAGCGTGATGGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_207633
VALIDATED
YIPF6 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 6
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000250569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207633.2-4735s21c1
Sequence:CCGGGAACTGATTGGACGTAGATATCTCGAGATATCTACGTCCAATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-984s21c1
Sequence:CCGGGACCAATAAACTTCATGATTCCTCGAGGAATCATGAAGTTTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207633.2-681s21c1
Sequence:CCGGTATATCCAAGGAAGAGTAATGCTCGAGCATTACTCTTCCTTGGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-631s21c1
Sequence:CCGGGACCATTATGCGAGATCTAAACTCGAGTTTAGATCTCGCATAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000250567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-516s21c1
Sequence:CCGGGGTTGTCTGATGTGTCAATTTCTCGAGAAATTGACACATCAGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_207633
VALIDATED
YIPF6 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 6
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000250569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207633.2-4735s21c1
Sequence:CCGGGAACTGATTGGACGTAGATATCTCGAGATATCTACGTCCAATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-984s21c1
Sequence:CCGGGACCAATAAACTTCATGATTCCTCGAGGAATCATGAAGTTTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207633.2-681s21c1
Sequence:CCGGTATATCCAAGGAAGAGTAATGCTCGAGCATTACTCTTCCTTGGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-631s21c1
Sequence:CCGGGACCATTATGCGAGATCTAAACTCGAGTTTAGATCTCGCATAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000250567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-516s21c1
Sequence:CCGGGGTTGTCTGATGTGTCAATTTCTCGAGAAATTGACACATCAGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_207633
VALIDATED
YIPF6 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 6
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000250569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_207633.2-4735s21c1
Sequence:CCGGGAACTGATTGGACGTAGATATCTCGAGATATCTACGTCCAATCAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-984s21c1
Sequence:CCGGGACCAATAAACTTCATGATTCCTCGAGGAATCATGAAGTTTATTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250570    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_207633.2-681s21c1
Sequence:CCGGTATATCCAAGGAAGAGTAATGCTCGAGCATTACTCTTCCTTGGATATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-631s21c1
Sequence:CCGGGACCATTATGCGAGATCTAAACTCGAGTTTAGATCTCGCATAATGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000250567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_207633.2-516s21c1
Sequence:CCGGGGTTGTCTGATGTGTCAATTTCTCGAGAAATTGACACATCAGACAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks