EMAIL THIS PAGE TO A FRIEND

YIPF7

Yip1 domain family, member 7

Synonyms: FinGER9
UniProtKB ID: Q8N8F6, Q3SY21, Q3SY22
Gene ID:
Mouse(75581) Yip1 domain family, member 7
Rat(364147) Yip1 domain family, member 7
chicken(422774) Yip1 domain family, member 7
dog(475137) Yip1 domain family, member 7
domestic cat(101091108) Yip1 domain family, member 7
cow(522186) Yip1 domain family, member 7
sheep(101120083) Yip1 domain family, member 7
domestic guinea pig(100720254) Yip1 domain family, member 7
naked mole-rat(101723234) Yip1 domain family, member 7
59 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_182592 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_182592 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_182592 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023784 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023784 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023784 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_182592 Rosetta Predictions human pricing
NM_001108861 Rosetta Predictions rat pricing
XM_344236 Rosetta Predictions rat pricing
NM_023784 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_182592 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00370725 predicted 430
2 SASI_Hs01_00074852 predicted 295
3 SASI_Hs02_00370726 predicted 262
4 SASI_Hs02_00370727 predicted 692
5 SASI_Hs02_00370728 predicted 298
6 SASI_Hs02_00370729 predicted 553
7 SASI_Hs02_00370730 predicted 408
8 SASI_Hs02_00370731 predicted 265
9 SASI_Hs02_00370732 predicted 292
10 SASI_Hs02_00370733 predicted 257
11 SASI_Hs01_00074851 predicted 320
12 SASI_Hs01_00074853 predicted 743
13 SASI_Hs01_00074854 predicted 579
14 SASI_Hs01_00074855 predicted 934
15 SASI_Hs01_00074856 predicted 630
16 SASI_Hs01_00074857 predicted 516
17 SASI_Hs01_00074858 predicted 323
18 SASI_Hs01_00074859 predicted 779
19 SASI_Hs01_00074860 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108861 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242805 predicted 768
2 SASI_Rn02_00242806 predicted 197
3 SASI_Rn02_00242807 predicted 507
4 SASI_Rn02_00242808 predicted 398
5 SASI_Rn02_00242809 predicted 315
6 SASI_Rn02_00242810 predicted 253
7 SASI_Rn02_00242811 predicted 882
8 SASI_Rn02_00242812 predicted 850
9 SASI_Rn02_00242813 predicted 530
10 SASI_Rn02_00242814 predicted 871
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344236 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178789 predicted 735
2 SASI_Rn01_00178790 predicted 466
3 SASI_Rn01_00178791 predicted 272
4 SASI_Rn01_00178792 predicted 217
5 SASI_Rn01_00178793 predicted 849
6 SASI_Rn01_00178794 predicted 807
7 SASI_Rn01_00178795 predicted 491
8 SASI_Rn01_00178796 predicted 838
9 SASI_Rn01_00178797 predicted 374
10 SASI_Rn01_00178798 predicted 484
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00142859 predicted 787
2 SASI_Mm01_00142860 predicted 269
3 SASI_Mm01_00142861 predicted 441
4 SASI_Mm01_00142862 predicted 534
5 SASI_Mm01_00142863 predicted 472
6 SASI_Mm01_00142865 predicted 556
7 SASI_Mm01_00142866 predicted 541
8 SASI_Mm01_00142867 predicted 335
9 SASI_Mm02_00327354 predicted 222
10 SASI_Mm02_00327355 predicted 335
11 SASI_Mm01_00142864 predicted 295
12 SASI_Mm01_00142868 predicted 721
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_182592
YIPF7 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 7
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000424327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182592.2-296s21c1
Sequence:CCGGAGCATCCAACTCAGATTATTACTCGAGTAATAATCTGAGTTGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182592.2-50s21c1
Sequence:CCGGACATTTACTGGAGGATCTTTCCTCGAGGAAAGATCCTCCAGTAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-254s1c1
Sequence:CCGGGATGCTCATGTCATCGGGTTACTCGAGTAACCCGATGACATGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-362s1c1
Sequence:CCGGGCTAGAAGAACTTGGAATCCACTCGAGTGGATTCCAAGTTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182592.1-48s1c1
Sequence:CCGGCTACATTTACTGGAGGATCTTCTCGAGAAGATCCTCCAGTAAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-446s1c1
Sequence:CCGGCATTATGAATGAAACGGACCTCTCGAGAGGTCCGTTTCATTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182592.1-901s1c1
Sequence:CCGGCACCATCTTCTTTGCTGTGATCTCGAGATCACAGCAAAGAAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-565s1c1
Sequence:CCGGCTGGCTTTGAAGCAATCTGTACTCGAGTACAGATTGCTTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_182592
YIPF7 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 7
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000424327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182592.2-296s21c1
Sequence:CCGGAGCATCCAACTCAGATTATTACTCGAGTAATAATCTGAGTTGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182592.2-50s21c1
Sequence:CCGGACATTTACTGGAGGATCTTTCCTCGAGGAAAGATCCTCCAGTAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-254s1c1
Sequence:CCGGGATGCTCATGTCATCGGGTTACTCGAGTAACCCGATGACATGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-362s1c1
Sequence:CCGGGCTAGAAGAACTTGGAATCCACTCGAGTGGATTCCAAGTTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182592.1-48s1c1
Sequence:CCGGCTACATTTACTGGAGGATCTTCTCGAGAAGATCCTCCAGTAAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-446s1c1
Sequence:CCGGCATTATGAATGAAACGGACCTCTCGAGAGGTCCGTTTCATTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182592.1-901s1c1
Sequence:CCGGCACCATCTTCTTTGCTGTGATCTCGAGATCACAGCAAAGAAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-565s1c1
Sequence:CCGGCTGGCTTTGAAGCAATCTGTACTCGAGTACAGATTGCTTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_182592
YIPF7 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 7
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000424327    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182592.2-296s21c1
Sequence:CCGGAGCATCCAACTCAGATTATTACTCGAGTAATAATCTGAGTTGGATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414726    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_182592.2-50s21c1
Sequence:CCGGACATTTACTGGAGGATCTTTCCTCGAGGAAAGATCCTCCAGTAAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-254s1c1
Sequence:CCGGGATGCTCATGTCATCGGGTTACTCGAGTAACCCGATGACATGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128917    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-362s1c1
Sequence:CCGGGCTAGAAGAACTTGGAATCCACTCGAGTGGATTCCAAGTTCTTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129680    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_182592.1-48s1c1
Sequence:CCGGCTACATTTACTGGAGGATCTTCTCGAGAAGATCCTCCAGTAAATGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-446s1c1
Sequence:CCGGCATTATGAATGAAACGGACCTCTCGAGAGGTCCGTTTCATTCATAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130110    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_182592.1-901s1c1
Sequence:CCGGCACCATCTTCTTTGCTGTGATCTCGAGATCACAGCAAAGAAGATGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_182592.1-565s1c1
Sequence:CCGGCTGGCTTTGAAGCAATCTGTACTCGAGTACAGATTGCTTCAAAGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023784
YIPF7 MISSION shRNA Bacterial Glycerol Stock
Yip1 domain family, member 7
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-140s21c1
Sequence:CCGGCCGAGTTGCAATGATTCTAATCTCGAGATTAGAATCATTGCAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-274s21c1
Sequence:CCGGAGCATCCAACTTGGATTATTACTCGAGTAATAATCCAAGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-275s1c1
Sequence:CCGGGCATCCAACTTGGATTATTACCTCGAGGTAATAATCCAAGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-340s1c1
Sequence:CCGGGCTAGAGGAACTTGGAATTAACTCGAGTTAATTCCAAGTTCCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-100s1c1
Sequence:CCGGGGGCTTCTACCAATCTAATTACTCGAGTAATTAGATTGGTAGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-100s21c1
Sequence:CCGGGGGCTTCTACCAATCTAATTACTCGAGTAATTAGATTGGTAGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-340s21c1
Sequence:CCGGGCTAGAGGAACTTGGAATTAACTCGAGTTAATTCCAAGTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023784.4-935s21c1
Sequence:CCGGGTTATTTCTGTTGCGAGAATACTCGAGTATTCTCGCAACAGAAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.2-127s1c1
Sequence:CCGGGCTTATGGAAATGTTTATGGACTCGAGTCCATAAACATTTCCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.2-196s1c1
Sequence:CCGGGAGATGTTCCTGCCATCAGATCTCGAGATCTGATGGCAGGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023784
YIPF7 MISSION shRNA shRNA Plasmid DNA
Yip1 domain family, member 7
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-140s21c1
Sequence:CCGGCCGAGTTGCAATGATTCTAATCTCGAGATTAGAATCATTGCAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-274s21c1
Sequence:CCGGAGCATCCAACTTGGATTATTACTCGAGTAATAATCCAAGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-275s1c1
Sequence:CCGGGCATCCAACTTGGATTATTACCTCGAGGTAATAATCCAAGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-340s1c1
Sequence:CCGGGCTAGAGGAACTTGGAATTAACTCGAGTTAATTCCAAGTTCCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-100s1c1
Sequence:CCGGGGGCTTCTACCAATCTAATTACTCGAGTAATTAGATTGGTAGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-100s21c1
Sequence:CCGGGGGCTTCTACCAATCTAATTACTCGAGTAATTAGATTGGTAGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-340s21c1
Sequence:CCGGGCTAGAGGAACTTGGAATTAACTCGAGTTAATTCCAAGTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023784.4-935s21c1
Sequence:CCGGGTTATTTCTGTTGCGAGAATACTCGAGTATTCTCGCAACAGAAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.2-127s1c1
Sequence:CCGGGCTTATGGAAATGTTTATGGACTCGAGTCCATAAACATTTCCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.2-196s1c1
Sequence:CCGGGAGATGTTCCTGCCATCAGATCTCGAGATCTGATGGCAGGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023784
YIPF7 MISSION shRNA Lentiviral Transduction Particles
Yip1 domain family, member 7
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249412    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-140s21c1
Sequence:CCGGCCGAGTTGCAATGATTCTAATCTCGAGATTAGAATCATTGCAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249415    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-274s21c1
Sequence:CCGGAGCATCCAACTTGGATTATTACTCGAGTAATAATCCAAGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215416    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-275s1c1
Sequence:CCGGGCATCCAACTTGGATTATTACCTCGAGGTAATAATCCAAGTTGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215566    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-340s1c1
Sequence:CCGGGCTAGAGGAACTTGGAATTAACTCGAGTTAATTCCAAGTTCCTCTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215742    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.4-100s1c1
Sequence:CCGGGGGCTTCTACCAATCTAATTACTCGAGTAATTAGATTGGTAGAAGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257870    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-100s21c1
Sequence:CCGGGGGCTTCTACCAATCTAATTACTCGAGTAATTAGATTGGTAGAAGCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249414    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023784.4-340s21c1
Sequence:CCGGGCTAGAGGAACTTGGAATTAACTCGAGTTAATTCCAAGTTCCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249413    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023784.4-935s21c1
Sequence:CCGGGTTATTTCTGTTGCGAGAATACTCGAGTATTCTCGCAACAGAAATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174840    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.2-127s1c1
Sequence:CCGGGCTTATGGAAATGTTTATGGACTCGAGTCCATAAACATTTCCATAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173919    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023784.2-196s1c1
Sequence:CCGGGAGATGTTCCTGCCATCAGATCTCGAGATCTGATGGCAGGAACATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks