EMAIL THIS PAGE TO A FRIEND

YJEFN3

YjeF N-terminal domain containing 3

UniProtKB ID: A6XGL0, A6XGK9, Q4G1C0
Gene ID:
Mouse(234365) YjeF N-terminal domain containing 3
Rat(498608) YjeF N-terminal domain containing 3
Zebrafish(557840) YjeF N-terminal domain containing 3
domestic cat(101100450) YjeF N-terminal domain containing 3
dog(484805) YjeF N-terminal domain containing 3
naked mole-rat(101720570) YjeF N-terminal domain containing 3
domestic guinea pig(100721969) YjeF N-terminal domain containing 3
cow(100848002) YjeF N-terminal domain containing 3
sheep(101104575) YjeF N-terminal domain containing 3
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198537 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198537 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198537 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_912305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_912305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_912305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198537 Rosetta Predictions human pricing
XM_001071564 Rosetta Predictions rat pricing
XM_573886 Rosetta Predictions rat pricing
XM_912305 Rosetta Predictions mouse pricing
XM_978251 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153465 predicted 300
2 SASI_Hs01_00153466 predicted 435
3 SASI_Hs01_00153467 predicted 208
4 SASI_Hs02_00372139 predicted 430
5 SASI_Hs01_00153468 predicted 501
6 SASI_Hs01_00153469 predicted 662
7 SASI_Hs01_00153471 predicted 428
8 SASI_Hs02_00372140 predicted 433
9 SASI_Hs02_00372141 predicted 353
10 SASI_Hs01_00153472 predicted 714
11 SASI_Hs01_00153470 predicted 590
12 SASI_Hs01_00153473 predicted 436
13 SASI_Hs01_00153474 predicted 763
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071564 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00335546 predicted 319
2 SASI_Rn02_00335547 predicted 340
3 SASI_Rn02_00335548 predicted 318
4 SASI_Rn02_00335549 predicted 308
5 SASI_Rn02_00335550 predicted 263
6 SASI_Rn02_00335551 predicted 488
7 SASI_Rn02_00335552 predicted 487
8 SASI_Rn02_00335553 predicted 507
9 SASI_Rn02_00335554 predicted 260
10 SASI_Rn02_00335555 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_573886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00400984 predicted 318
2 SASI_Rn02_00400985 predicted 334
3 SASI_Rn02_00400986 predicted 323
4 SASI_Rn02_00400987 predicted 304
5 SASI_Rn02_00400988 predicted 267
6 SASI_Rn02_00400989 predicted 480
7 SASI_Rn02_00400990 predicted 483
8 SASI_Rn02_00400991 predicted 500
9 SASI_Rn02_00400992 predicted 262
10 SASI_Rn02_00400993 predicted 317
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_912305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00436966 predicted 338
2 SASI_Mm02_00436967 predicted 749
3 SASI_Mm02_00436968 predicted 677
4 SASI_Mm02_00436969 predicted 741
5 SASI_Mm02_00436970 predicted 677
6 SASI_Mm02_00436971 predicted 852
7 SASI_Mm02_00436972 predicted 693
8 SASI_Mm02_00436973 predicted 674
9 SASI_Mm02_00436974 predicted 739
10 SASI_Mm02_00436975 predicted 756
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_978251 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00232568 predicted 342
2 SASI_Mm01_00232569 predicted 749
3 SASI_Mm01_00232570 predicted 677
4 SASI_Mm01_00232571 predicted 739
5 SASI_Mm01_00232572 predicted 680
6 SASI_Mm01_00232573 predicted 686
7 SASI_Mm01_00232574 predicted 674
8 SASI_Mm01_00232575 predicted 738
9 SASI_Mm01_00232576 predicted 760
10 SASI_Mm01_00232577 predicted 508
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198537
YJEFN3 MISSION shRNA Bacterial Glycerol Stock
YjeF N-terminal domain containing 3
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-119s21c1
Sequence:CCGGAGAGCGGAGCTTAGCTCAAATCTCGAGATTTGAGCTAAGCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-570s21c1
Sequence:CCGGAGCTCATTAACGAAGCCTATGCTCGAGCATAGGCTTCGTTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-187s21c1
Sequence:CCGGGTCATGGCTAGAGCAGATTTGCTCGAGCAAATCTGCTCTAGCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-264s21c1
Sequence:CCGGTGCTGGAGGATTATCGCTTTGCTCGAGCAAAGCGATAATCCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000242645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-440s21c1
Sequence:CCGGCTGCGGGTGTTTGAGTATGAACTCGAGTTCATACTCAAACACCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198537
YJEFN3 MISSION shRNA shRNA Plasmid DNA
YjeF N-terminal domain containing 3
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-119s21c1
Sequence:CCGGAGAGCGGAGCTTAGCTCAAATCTCGAGATTTGAGCTAAGCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-570s21c1
Sequence:CCGGAGCTCATTAACGAAGCCTATGCTCGAGCATAGGCTTCGTTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-187s21c1
Sequence:CCGGGTCATGGCTAGAGCAGATTTGCTCGAGCAAATCTGCTCTAGCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-264s21c1
Sequence:CCGGTGCTGGAGGATTATCGCTTTGCTCGAGCAAAGCGATAATCCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000242645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-440s21c1
Sequence:CCGGCTGCGGGTGTTTGAGTATGAACTCGAGTTCATACTCAAACACCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198537
YJEFN3 MISSION shRNA Lentiviral Transduction Particles
YjeF N-terminal domain containing 3
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256996    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-119s21c1
Sequence:CCGGAGAGCGGAGCTTAGCTCAAATCTCGAGATTTGAGCTAAGCTCCGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-570s21c1
Sequence:CCGGAGCTCATTAACGAAGCCTATGCTCGAGCATAGGCTTCGTTAATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-187s21c1
Sequence:CCGGGTCATGGCTAGAGCAGATTTGCTCGAGCAAATCTGCTCTAGCCATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242648    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-264s21c1
Sequence:CCGGTGCTGGAGGATTATCGCTTTGCTCGAGCAAAGCGATAATCCTCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000242645    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198537.2-440s21c1
Sequence:CCGGCTGCGGGTGTTTGAGTATGAACTCGAGTTCATACTCAAACACCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_912305
YJEFN3 MISSION shRNA Bacterial Glycerol Stock
YjeF N-terminal domain containing 3
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000219502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-136s1c1
Sequence:CCGGGAACTATGTGGGCACGCTAGTCTCGAGACTAGCGTGCCCACATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-749s1c1
Sequence:CCGGCACTGTGAACCGCACCAATAACTCGAGTTATTGGTGCGGTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_912305.2-868s1c1
Sequence:CCGGGCCGTGGAGTTTCTTAGAATGCTCGAGCATTCTAAGAAACTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-686s1c1
Sequence:CCGGATGACGTCCGCCGAAAGTTTGCTCGAGCAAACTTTCGGCGGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-98s1c1
Sequence:CCGGTACTGGAGGAGTACCGCTTTGCTCGAGCAAAGCGGTACTCCTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_912305
YJEFN3 MISSION shRNA shRNA Plasmid DNA
YjeF N-terminal domain containing 3
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000219502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-136s1c1
Sequence:CCGGGAACTATGTGGGCACGCTAGTCTCGAGACTAGCGTGCCCACATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-749s1c1
Sequence:CCGGCACTGTGAACCGCACCAATAACTCGAGTTATTGGTGCGGTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_912305.2-868s1c1
Sequence:CCGGGCCGTGGAGTTTCTTAGAATGCTCGAGCATTCTAAGAAACTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-686s1c1
Sequence:CCGGATGACGTCCGCCGAAAGTTTGCTCGAGCAAACTTTCGGCGGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-98s1c1
Sequence:CCGGTACTGGAGGAGTACCGCTTTGCTCGAGCAAAGCGGTACTCCTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_912305
YJEFN3 MISSION shRNA Lentiviral Transduction Particles
YjeF N-terminal domain containing 3
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000219502    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-136s1c1
Sequence:CCGGGAACTATGTGGGCACGCTAGTCTCGAGACTAGCGTGCCCACATAGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219504    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-749s1c1
Sequence:CCGGCACTGTGAACCGCACCAATAACTCGAGTTATTGGTGCGGTTCACAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219505    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_912305.2-868s1c1
Sequence:CCGGGCCGTGGAGTTTCTTAGAATGCTCGAGCATTCTAAGAAACTCCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219503    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-686s1c1
Sequence:CCGGATGACGTCCGCCGAAAGTTTGCTCGAGCAAACTTTCGGCGGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219501    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:XM_912305.2-98s1c1
Sequence:CCGGTACTGGAGGAGTACCGCTTTGCTCGAGCAAAGCGGTACTCCTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks