EMAIL THIS PAGE TO A FRIEND

YKT6

YKT6 v-SNARE homolog (S. cerevisiae)

UniProtKB ID: O15498, Q53F01, Q6FGU9, Q6IB15
Gene ID:
Human(10652) Summary: This gene product is one of the SNARE recognition molecules implicated in vesicular transport between secretory compartments. It is a membrane associated, isoprenylated protein that functions at the endoplasmic reticulum-Golgi transport step. This protein is highly conserved from yeast to human and can functionally complement the loss of the yeast homolog in the yeast secretory pathway. [provided by RefSeq, Jul 2008]
Mouse(56418) YKT6 homolog (S. Cerevisiae)
Rat(64351) YKT6 v-SNARE homolog (S. cerevisiae)
fruit fly(31706) CG1515 gene product from transcript CG1515-RA
Zebrafish(394067) YKT6 v-SNARE homolog (S. cerevisiae)
chicken(430371) YKT6 v-SNARE homolog (S. cerevisiae)
domestic cat(101095563) YKT6 v-SNARE homolog (S. cerevisiae)
dog(475497) synaptobrevin homolog YKT6-like
cow(507409) YKT6 v-SNARE homolog (S. cerevisiae)
sheep(101116901) YKT6 v-SNARE homolog (S. cerevisiae)
domestic guinea pig(100727287) YKT6 v-SNARE homolog (S. cerevisiae)
naked mole-rat(101720497) YKT6 v-SNARE homolog (S. cerevisiae)
54 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006555 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006555 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006555 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019661 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019661 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019661 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU049611 MISSION® esiRNA esiRNA human YKT6 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006555 Rosetta Predictions human pricing
NM_031692 Rosetta Predictions rat pricing
NM_019661 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006555 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00027817 predicted 221
2 SASI_Hs01_00027818 predicted 693
3 SASI_Hs02_00341820 predicted 998
4 SASI_Hs01_00027819 predicted 265
5 SASI_Hs01_00027822 predicted 460
6 SASI_Hs02_00341821 predicted 1014
7 SASI_Hs01_00027823 predicted 625
8 SASI_Hs01_00027824 predicted 204
9 SASI_Hs01_00027825 predicted 579
10 SASI_Hs02_00341822 predicted 334
11 SASI_Hs01_00027816 predicted 388
12 SASI_Hs01_00027820 predicted 912
13 SASI_Hs01_00027821 predicted 651
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031692 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00265037 predicted 299
2 SASI_Rn01_00073628 predicted 341
3 SASI_Rn01_00073629 predicted 214
4 SASI_Rn01_00073630 predicted 366
5 SASI_Rn01_00073631 predicted 373
6 SASI_Rn01_00073632 predicted 253
7 SASI_Rn01_00073633 predicted 231
8 SASI_Rn01_00073634 predicted 215
9 SASI_Rn01_00073635 predicted 210
10 SASI_Rn01_00073636 predicted 363
11 SASI_Rn01_00073627 predicted 301
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019661 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123342 predicted 499
2 SASI_Mm01_00123343 predicted 373
3 SASI_Mm01_00123344 predicted 368
4 SASI_Mm01_00123345 predicted 313
5 SASI_Mm01_00123346 predicted 558
6 SASI_Mm01_00123347 predicted 706
7 SASI_Mm02_00324711 predicted 344
8 SASI_Mm01_00123348 predicted 809
9 SASI_Mm02_00324712 predicted 596
10 SASI_Mm01_00123349 predicted 685
11 SASI_Mm01_00123350 predicted 784
12 SASI_Mm01_00123351 predicted 614
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006555
VALIDATED
YKT6 MISSION shRNA Bacterial Glycerol Stock
YKT6 v-SNARE homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-358s21c1
Sequence:GTACCGGCGTCTACGTCCGGAATGATAGCTCGAGCTATCATTCCGGACGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-558s21c1
Sequence:CCGGGAGAAGCTGATCCCATGACTACTCGAGTAGTCATGGGATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006555.3-694s21c1
Sequence:CCGGACAGTCTAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006555.3-587s21c1
Sequence:CCGGGCCGAACTAGATGAGACCAAACTCGAGTTTGGTCTCATCTAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-220s21c1
Sequence:CCGGCGCATACGATGTGTCTTCCTTCTCGAGAAGGAAGACACATCGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006555.3-985s21c1
Sequence:GTACCGGTGGGCAAATGAAACCATAAACCTCGAGGTTTATGGTTTCATTTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-279s21c1
Sequence:GTACCGGCCTTCACGAGTCAACTGATTGCTCGAGCAATCAGTTGACTCGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006555.3-909s21c1
Sequence:GTACCGGAGGGTGGCGAATGTTCAAATTCTCGAGAATTTGAACATTCGCCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-587s1c1
Sequence:CCGGGCCGAACTAGATGAGACCAAACTCGAGTTTGGTCTCATCTAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-558s1c1
Sequence:CCGGGAGAAGCTGATCCCATGACTACTCGAGTAGTCATGGGATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-694s1c1
Sequence:CCGGACAGTCTAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-368s1c1
Sequence:CCGGCGGAATGATAGTCTTGCAGGTCTCGAGACCTGCAAGACTATCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-220s1c1
Sequence:CCGGCGCATACGATGTGTCTTCCTTCTCGAGAAGGAAGACACATCGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006555
VALIDATED
YKT6 MISSION shRNA shRNA Plasmid DNA
YKT6 v-SNARE homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-358s21c1
Sequence:GTACCGGCGTCTACGTCCGGAATGATAGCTCGAGCTATCATTCCGGACGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-558s21c1
Sequence:CCGGGAGAAGCTGATCCCATGACTACTCGAGTAGTCATGGGATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006555.3-694s21c1
Sequence:CCGGACAGTCTAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006555.3-587s21c1
Sequence:CCGGGCCGAACTAGATGAGACCAAACTCGAGTTTGGTCTCATCTAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-220s21c1
Sequence:CCGGCGCATACGATGTGTCTTCCTTCTCGAGAAGGAAGACACATCGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006555.3-985s21c1
Sequence:GTACCGGTGGGCAAATGAAACCATAAACCTCGAGGTTTATGGTTTCATTTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-279s21c1
Sequence:GTACCGGCCTTCACGAGTCAACTGATTGCTCGAGCAATCAGTTGACTCGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006555.3-909s21c1
Sequence:GTACCGGAGGGTGGCGAATGTTCAAATTCTCGAGAATTTGAACATTCGCCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-587s1c1
Sequence:CCGGGCCGAACTAGATGAGACCAAACTCGAGTTTGGTCTCATCTAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-558s1c1
Sequence:CCGGGAGAAGCTGATCCCATGACTACTCGAGTAGTCATGGGATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-694s1c1
Sequence:CCGGACAGTCTAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-368s1c1
Sequence:CCGGCGGAATGATAGTCTTGCAGGTCTCGAGACCTGCAAGACTATCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-220s1c1
Sequence:CCGGCGCATACGATGTGTCTTCCTTCTCGAGAAGGAAGACACATCGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006555
VALIDATED
YKT6 MISSION shRNA Lentiviral Transduction Particles
YKT6 v-SNARE homolog (S. cerevisiae)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382286    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-358s21c1
Sequence:GTACCGGCGTCTACGTCCGGAATGATAGCTCGAGCTATCATTCCGGACGTAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299713    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-558s21c1
Sequence:CCGGGAGAAGCTGATCCCATGACTACTCGAGTAGTCATGGGATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_006555.3-694s21c1
Sequence:CCGGACAGTCTAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 2 Clone ID:NM_006555.3-587s21c1
Sequence:CCGGGCCGAACTAGATGAGACCAAACTCGAGTTTGGTCTCATCTAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299710    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-220s21c1
Sequence:CCGGCGCATACGATGTGTCTTCCTTCTCGAGAAGGAAGACACATCGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380048    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006555.3-985s21c1
Sequence:GTACCGGTGGGCAAATGAAACCATAAACCTCGAGGTTTATGGTTTCATTTGCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006555.3-279s21c1
Sequence:GTACCGGCCTTCACGAGTCAACTGATTGCTCGAGCAATCAGTTGACTCGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006555.3-909s21c1
Sequence:GTACCGGAGGGTGGCGAATGTTCAAATTCTCGAGAATTTGAACATTCGCCACCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-587s1c1
Sequence:CCGGGCCGAACTAGATGAGACCAAACTCGAGTTTGGTCTCATCTAGTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-558s1c1
Sequence:CCGGGAGAAGCTGATCCCATGACTACTCGAGTAGTCATGGGATCAGCTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-694s1c1
Sequence:CCGGACAGTCTAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTAGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-368s1c1
Sequence:CCGGCGGAATGATAGTCTTGCAGGTCTCGAGACCTGCAAGACTATCATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006555.3-220s1c1
Sequence:CCGGCGCATACGATGTGTCTTCCTTCTCGAGAAGGAAGACACATCGTATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019661
VALIDATED
YKT6 MISSION shRNA Bacterial Glycerol Stock
YKT6 v-SNARE homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019661.3-867s21c1
Sequence:CCGGCCAAGATGTAATGTTGGGAAACTCGAGTTTCCCAACATTACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-606s21c1
Sequence:CCGGACAGTCGAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-435s21c1
Sequence:CCGGCCTGGACGATCACCTTAGTAACTCGAGTTACTAAGGTGATCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019661.3-138s21c1
Sequence:CCGGCGACGTGTCTTCCTTTAGTTTCTCGAGAAACTAAAGGAAGACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-529s21c1
Sequence:GTACCGGCACAACACCATGGAGTCTTTGCTCGAGCAAAGACTCCATGGTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-472s21c1
Sequence:GTACCGGGAAGCTGATCCCATGAGTAAACTCGAGTTTACTCATGGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-867s1c1
Sequence:CCGGCCAAGATGTAATGTTGGGAAACTCGAGTTTCCCAACATTACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-606s1c1
Sequence:CCGGACAGTCGAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-434s1c1
Sequence:CCGGGCCTGGACGATCACCTTAGTACTCGAGTACTAAGGTGATCGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-138s1c1
Sequence:CCGGCGACGTGTCTTCCTTTAGTTTCTCGAGAAACTAAAGGAAGACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-435s1c1
Sequence:CCGGCCTGGACGATCACCTTAGTAACTCGAGTTACTAAGGTGATCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019661
VALIDATED
YKT6 MISSION shRNA shRNA Plasmid DNA
YKT6 v-SNARE homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019661.3-867s21c1
Sequence:CCGGCCAAGATGTAATGTTGGGAAACTCGAGTTTCCCAACATTACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-606s21c1
Sequence:CCGGACAGTCGAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-435s21c1
Sequence:CCGGCCTGGACGATCACCTTAGTAACTCGAGTTACTAAGGTGATCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019661.3-138s21c1
Sequence:CCGGCGACGTGTCTTCCTTTAGTTTCTCGAGAAACTAAAGGAAGACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-529s21c1
Sequence:GTACCGGCACAACACCATGGAGTCTTTGCTCGAGCAAAGACTCCATGGTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-472s21c1
Sequence:GTACCGGGAAGCTGATCCCATGAGTAAACTCGAGTTTACTCATGGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-867s1c1
Sequence:CCGGCCAAGATGTAATGTTGGGAAACTCGAGTTTCCCAACATTACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-606s1c1
Sequence:CCGGACAGTCGAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-434s1c1
Sequence:CCGGGCCTGGACGATCACCTTAGTACTCGAGTACTAAGGTGATCGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-138s1c1
Sequence:CCGGCGACGTGTCTTCCTTTAGTTTCTCGAGAAACTAAAGGAAGACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-435s1c1
Sequence:CCGGCCTGGACGATCACCTTAGTAACTCGAGTTACTAAGGTGATCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019661
VALIDATED
YKT6 MISSION shRNA Lentiviral Transduction Particles
YKT6 v-SNARE homolog (S. cerevisiae)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314272    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_019661.3-867s21c1
Sequence:CCGGCCAAGATGTAATGTTGGGAAACTCGAGTTTCCCAACATTACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-606s21c1
Sequence:CCGGACAGTCGAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314270    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-435s21c1
Sequence:CCGGCCTGGACGATCACCTTAGTAACTCGAGTTACTAAGGTGATCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019661.3-138s21c1
Sequence:CCGGCGACGTGTCTTCCTTTAGTTTCTCGAGAAACTAAAGGAAGACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-529s21c1
Sequence:GTACCGGCACAACACCATGGAGTCTTTGCTCGAGCAAAGACTCCATGGTGTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381852    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019661.3-472s21c1
Sequence:GTACCGGGAAGCTGATCCCATGAGTAAACTCGAGTTTACTCATGGGATCAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-867s1c1
Sequence:CCGGCCAAGATGTAATGTTGGGAAACTCGAGTTTCCCAACATTACATCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-606s1c1
Sequence:CCGGACAGTCGAAAGCCTTCTATAACTCGAGTTATAGAAGGCTTTCGACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-434s1c1
Sequence:CCGGGCCTGGACGATCACCTTAGTACTCGAGTACTAAGGTGATCGTCCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-138s1c1
Sequence:CCGGCGACGTGTCTTCCTTTAGTTTCTCGAGAAACTAAAGGAAGACACGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019661.2-435s1c1
Sequence:CCGGCCTGGACGATCACCTTAGTAACTCGAGTTACTAAGGTGATCGTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks