EMAIL THIS PAGE TO A FRIEND

YLPM1

YLP motif containing 1

Synonyms: C14orf170 ZAP113 ZAP3
UniProtKB ID: P49750, P49752, Q96I64, Q9P1V7
Gene ID:
Mouse(56531) YLP motif containing 1
Rat(299199) YLP motif containing 1
Zebrafish(561348) YLP motif containing 1
chicken(423356) YLP motif containing 1
dog(480387) YLP motif containing 1
Horse(100051204) YLP motif containing 1
domestic cat(101083270) YLP motif containing 1
naked mole-rat(101697773) YLP motif containing 1
domestic guinea pig(100723376) YLP motif containing 1
cow(540849) YLP motif containing 1
sheep(101108136) YLP motif containing 1
168 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178363 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178363 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178363 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_019589 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_019589 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_019589 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_019589 Rosetta Predictions human pricing
XM_085151 Rosetta Predictions human pricing
XM_930487 Rosetta Predictions human pricing
XM_935024 Rosetta Predictions human pricing
XM_935026 Rosetta Predictions human pricing
XM_935028 Rosetta Predictions human pricing
XM_935030 Rosetta Predictions human pricing
XM_935032 Rosetta Predictions human pricing
XM_935034 Rosetta Predictions human pricing
XM_001057111 Rosetta Predictions rat pricing
XM_234416 Rosetta Predictions rat pricing
NM_178363 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019589 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352768 predicted 2312
2 SASI_Hs02_00352769 predicted 4181
3 SASI_Hs02_00352770 predicted 5300
4 SASI_Hs02_00352771 predicted 4226
5 SASI_Hs02_00352772 predicted 2166
6 SASI_Hs02_00352773 predicted 3281
7 SASI_Hs02_00352774 predicted 5024
8 SASI_Hs02_00352775 predicted 3940
9 SASI_Hs02_00352776 predicted 2340
10 SASI_Hs02_00352777 predicted 3282
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_085151 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00272122 predicted 4187
2 SASI_Hs01_00272123 predicted 1508
3 SASI_Hs01_00272124 predicted 5297
4 SASI_Hs01_00272125 predicted 4225
5 SASI_Hs01_00272126 predicted 5923
6 SASI_Hs01_00272127 predicted 2713
7 SASI_Hs01_00272128 predicted 2171
8 SASI_Hs01_00272129 predicted 3273
9 SASI_Hs01_00272130 predicted 5026
10 SASI_Hs01_00272131 predicted 3931
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_930487 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00276464 predicted 6481
2 SASI_Hs01_00276465 predicted 6421
3 SASI_Hs01_00276466 predicted 4185
4 SASI_Hs01_00276467 predicted 5303
5 SASI_Hs01_00276468 predicted 4229
6 SASI_Hs01_00276469 predicted 2170
7 SASI_Hs01_00276470 predicted 6591
8 SASI_Hs01_00276471 predicted 3275
9 SASI_Hs01_00276472 predicted 5027
10 SASI_Hs01_00276473 predicted 3933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935024 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00299978 predicted 4178
2 SASI_Hs01_00299979 predicted 1510
3 SASI_Hs01_00299980 predicted 5295
4 SASI_Hs01_00299981 predicted 4226
5 SASI_Hs01_00299982 predicted 5925
6 SASI_Hs01_00299983 predicted 2709
7 SASI_Hs01_00299984 predicted 2166
8 SASI_Hs01_00299985 predicted 3279
9 SASI_Hs01_00299986 predicted 5020
10 SASI_Hs01_00299987 predicted 3934
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935026 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00291353 predicted 4180
2 SASI_Hs01_00291354 predicted 1502
3 SASI_Hs01_00291355 predicted 5294
4 SASI_Hs01_00291356 predicted 4220
5 SASI_Hs01_00291357 predicted 5925
6 SASI_Hs01_00291358 predicted 2714
7 SASI_Hs01_00291359 predicted 2168
8 SASI_Hs01_00291360 predicted 3278
9 SASI_Hs01_00291361 predicted 5025
10 SASI_Hs01_00291362 predicted 3930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935028 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00282946 predicted 526
2 SASI_Hs01_00282947 predicted 921
3 SASI_Hs01_00282948 predicted 307
4 SASI_Hs01_00282949 predicted 1008
5 SASI_Hs01_00282950 predicted 906
6 SASI_Hs01_00282951 predicted 628
7 SASI_Hs01_00282952 predicted 837
8 SASI_Hs01_00282953 predicted 579
9 SASI_Hs01_00282954 predicted 1017
10 SASI_Hs01_00282955 predicted 769
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00278273 predicted 2191
2 SASI_Hs01_00278274 predicted 2140
3 SASI_Hs01_00278275 predicted 1974
4 SASI_Hs01_00278276 predicted 1813
5 SASI_Hs01_00278277 predicted 1018
6 SASI_Hs01_00278278 predicted 553
7 SASI_Hs01_00278279 predicted 1632
8 SASI_Hs01_00278280 predicted 1333
9 SASI_Hs01_00278281 predicted 2304
10 SASI_Hs01_00278282 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935032 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00264959 predicted 4180
2 SASI_Hs01_00264960 predicted 1511
3 SASI_Hs01_00264961 predicted 5303
4 SASI_Hs01_00264962 predicted 4221
5 SASI_Hs01_00264963 predicted 5917
6 SASI_Hs01_00264964 predicted 2709
7 SASI_Hs01_00264965 predicted 2167
8 SASI_Hs01_00264966 predicted 3278
9 SASI_Hs01_00264967 predicted 5021
10 SASI_Hs01_00264968 predicted 3933
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_935034 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00248681 predicted 4181
2 SASI_Hs01_00248682 predicted 1505
3 SASI_Hs01_00248683 predicted 5296
4 SASI_Hs01_00248684 predicted 4220
5 SASI_Hs01_00248685 predicted 5916
6 SASI_Hs01_00248686 predicted 2713
7 SASI_Hs01_00248687 predicted 2166
8 SASI_Hs01_00248688 predicted 3272
9 SASI_Hs01_00248689 predicted 5025
10 SASI_Hs01_00248690 predicted 3930
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001057111 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00285449 predicted 3015
2 SASI_Rn02_00285450 predicted 1136
3 SASI_Rn02_00285451 predicted 3147
4 SASI_Rn02_00285452 predicted 3029
5 SASI_Rn02_00285453 predicted 2066
6 SASI_Rn02_00285454 predicted 3852
7 SASI_Rn02_00285455 predicted 973
8 SASI_Rn02_00285456 predicted 3059
9 SASI_Rn02_00285457 predicted 2895
10 SASI_Rn02_00285458 predicted 2087
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234416 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388469 predicted 3015
2 SASI_Rn02_00388470 predicted 1137
3 SASI_Rn02_00388471 predicted 3155
4 SASI_Rn02_00388472 predicted 3029
5 SASI_Rn02_00388473 predicted 2062
6 SASI_Rn02_00388474 predicted 3844
7 SASI_Rn02_00388475 predicted 971
8 SASI_Rn02_00388476 predicted 3057
9 SASI_Rn02_00388477 predicted 2893
10 SASI_Rn02_00388478 predicted 2088
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178363 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348745 predicted 4213
2 SASI_Mm01_00187836 predicted 2390
3 SASI_Mm02_00348746 predicted 5899
4 SASI_Mm01_00187837 predicted 5441
5 SASI_Mm02_00348747 predicted 3816
6 SASI_Mm02_00348748 predicted 4252
7 SASI_Mm01_00187838 predicted 5374
8 SASI_Mm01_00187840 predicted 5097
9 SASI_Mm02_00348749 predicted 5855
10 SASI_Mm01_00187843 predicted 5333
11 SASI_Mm01_00187839 predicted 3147
12 SASI_Mm01_00187841 predicted 4252
13 SASI_Mm01_00187842 predicted 2075
14 SASI_Mm01_00187844 predicted 3007
15 SASI_Mm01_00187845 predicted 2030
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178363
VALIDATED
YLPM1 MISSION shRNA Bacterial Glycerol Stock
YLP motif containing 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000124904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-4447s1c1
Sequence:CCGGGCTATATCCAAGCAAGACATTCTCGAGAATGTCTTGCTTGGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-759s1c1
Sequence:CCGGGCCAAGAACAAGACTGCTGAACTCGAGTTCAGCAGTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-2761s1c1
Sequence:CCGGGCCGAGATATGCCTACTAATACTCGAGTATTAGTAGGCATATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-2919s1c1
Sequence:CCGGCGTCCAAGTAATATAACAGATCTCGAGATCTGTTATATTACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-3384s1c1
Sequence:CCGGCGGGATAAGGAAGTAGAATTTCTCGAGAAATTCTACTTCCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-800s21c1
Sequence:CCGGTCGTCCTCCTCACAATCATATCTCGAGATATGATTGTGAGGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5711s21c1
Sequence:CCGGCGGGATAAGGAAGTAGAATTTCTCGAGAAATTCTACTTCCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-968s21c1
Sequence:CCGGGCCAAGAACAAGACTGCTGAACTCGAGTTCAGCAGTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5089s21c1
Sequence:CCGGCCGAGATATGCCTACTAATAACTCGAGTTATTAGTAGGCATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5246s21c1
Sequence:CCGGCGTCCAAGTAATATAACAGATCTCGAGATCTGTTATATTACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178363
VALIDATED
YLPM1 MISSION shRNA shRNA Plasmid DNA
YLP motif containing 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000124904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-4447s1c1
Sequence:CCGGGCTATATCCAAGCAAGACATTCTCGAGAATGTCTTGCTTGGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-759s1c1
Sequence:CCGGGCCAAGAACAAGACTGCTGAACTCGAGTTCAGCAGTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-2761s1c1
Sequence:CCGGGCCGAGATATGCCTACTAATACTCGAGTATTAGTAGGCATATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-2919s1c1
Sequence:CCGGCGTCCAAGTAATATAACAGATCTCGAGATCTGTTATATTACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-3384s1c1
Sequence:CCGGCGGGATAAGGAAGTAGAATTTCTCGAGAAATTCTACTTCCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-800s21c1
Sequence:CCGGTCGTCCTCCTCACAATCATATCTCGAGATATGATTGTGAGGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5711s21c1
Sequence:CCGGCGGGATAAGGAAGTAGAATTTCTCGAGAAATTCTACTTCCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-968s21c1
Sequence:CCGGGCCAAGAACAAGACTGCTGAACTCGAGTTCAGCAGTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5089s21c1
Sequence:CCGGCCGAGATATGCCTACTAATAACTCGAGTTATTAGTAGGCATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5246s21c1
Sequence:CCGGCGTCCAAGTAATATAACAGATCTCGAGATCTGTTATATTACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178363
VALIDATED
YLPM1 MISSION shRNA Lentiviral Transduction Particles
YLP motif containing 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000124904    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-4447s1c1
Sequence:CCGGGCTATATCCAAGCAAGACATTCTCGAGAATGTCTTGCTTGGATATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-759s1c1
Sequence:CCGGGCCAAGAACAAGACTGCTGAACTCGAGTTCAGCAGTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124906    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-2761s1c1
Sequence:CCGGGCCGAGATATGCCTACTAATACTCGAGTATTAGTAGGCATATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-2919s1c1
Sequence:CCGGCGTCCAAGTAATATAACAGATCTCGAGATCTGTTATATTACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178363.2-3384s1c1
Sequence:CCGGCGGGATAAGGAAGTAGAATTTCTCGAGAAATTCTACTTCCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-800s21c1
Sequence:CCGGTCGTCCTCCTCACAATCATATCTCGAGATATGATTGTGAGGAGGACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5711s21c1
Sequence:CCGGCGGGATAAGGAAGTAGAATTTCTCGAGAAATTCTACTTCCTTATCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-968s21c1
Sequence:CCGGGCCAAGAACAAGACTGCTGAACTCGAGTTCAGCAGTCTTGTTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312876    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5089s21c1
Sequence:CCGGCCGAGATATGCCTACTAATAACTCGAGTTATTAGTAGGCATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311829    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178363.3-5246s21c1
Sequence:CCGGCGTCCAAGTAATATAACAGATCTCGAGATCTGTTATATTACTTGGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019589
VALIDATED
YLPM1 MISSION shRNA Bacterial Glycerol Stock
YLP motif containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000247695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-6753s21c1
Sequence:CCGGTACCCAAGCAAGACGTTAATTCTCGAGAATTAACGTCTTGCTTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019589.2-3217s21c1
Sequence:CCGGACGGGATAAAGGTCTAGTAAACTCGAGTTTACTAGACCTTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019589.2-1373s21c1
Sequence:CCGGCAACAGTATCAGCAGATTATACTCGAGTATAATCTGCTGATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-4862s21c1
Sequence:CCGGTATGGGCTCTGGGATACAAATCTCGAGATTTGTATCCCAGAGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000247694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-5059s21c1
Sequence:CCGGCCGAGATATATCCACTAATAACTCGAGTTATTAGTGGATATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019589
VALIDATED
YLPM1 MISSION shRNA shRNA Plasmid DNA
YLP motif containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000247695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-6753s21c1
Sequence:CCGGTACCCAAGCAAGACGTTAATTCTCGAGAATTAACGTCTTGCTTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019589.2-3217s21c1
Sequence:CCGGACGGGATAAAGGTCTAGTAAACTCGAGTTTACTAGACCTTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019589.2-1373s21c1
Sequence:CCGGCAACAGTATCAGCAGATTATACTCGAGTATAATCTGCTGATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-4862s21c1
Sequence:CCGGTATGGGCTCTGGGATACAAATCTCGAGATTTGTATCCCAGAGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000247694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-5059s21c1
Sequence:CCGGCCGAGATATATCCACTAATAACTCGAGTTATTAGTGGATATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019589
VALIDATED
YLPM1 MISSION shRNA Lentiviral Transduction Particles
YLP motif containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000247695    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-6753s21c1
Sequence:CCGGTACCCAAGCAAGACGTTAATTCTCGAGAATTAACGTCTTGCTTGGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247697    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019589.2-3217s21c1
Sequence:CCGGACGGGATAAAGGTCTAGTAAACTCGAGTTTACTAGACCTTTATCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247698    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019589.2-1373s21c1
Sequence:CCGGCAACAGTATCAGCAGATTATACTCGAGTATAATCTGCTGATACTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-4862s21c1
Sequence:CCGGTATGGGCTCTGGGATACAAATCTCGAGATTTGTATCCCAGAGCCCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000247694    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: A549
TRC Version: 2 Clone ID:NM_019589.2-5059s21c1
Sequence:CCGGCCGAGATATATCCACTAATAACTCGAGTTATTAGTGGATATATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks