EMAIL THIS PAGE TO A FRIEND

YME1L1

YME1-like 1 ATPase

Synonyms: FTSH MEG4 PAMP YME1L
Gene ID:
Human(10730) Summary: The protein encoded by this gene is the human ortholog of yeast mitochondrial AAA metalloprotease, Yme1p. It is localized in the mitochondria and can functionally complement a yme1 disruptant yeast strain. It is proposed that this gene plays a role in mitochondrial protein metabolism and could be involved in mitochondrial pathologies. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
Mouse(27377) YME1-like 1 (S. cerevisiae)
Rat(114217) YME1-like 1 ATPase
cow(505118) YME1-like 1 (S. cerevisiae)
sheep(101118628) YME1-like 1 (S. cerevisiae)
domestic guinea pig(101787012) YME1-like 1 ATPase
naked mole-rat(101722494) YME1-like 1 ATPase
Domestic Rabbit(100352946) YME1-like 1 (S. cerevisiae)
chicken(428418) YME1-like 1 (S. cerevisiae)
dog(477988) YME1-like 1 (S. cerevisiae)
domestic cat(101084035) YME1-like 1 (S. cerevisiae)
Horse(100065311) YME1-like 1 (S. cerevisiae)
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013771 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013771 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013771 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014263 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014263 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014263 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014263 Rosetta Predictions human pricing
NM_139312 Rosetta Predictions human pricing
NM_139313 Rosetta Predictions human pricing
NM_053682 Rosetta Predictions rat pricing
NM_013771 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014263 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00031219 predicted 1225
2 SASI_Hs01_00031220 predicted 1012
3 SASI_Hs02_00345322 predicted 1417
4 SASI_Hs01_00031222 predicted 1477
5 SASI_Hs01_00031223 predicted 1454
6 SASI_Hs01_00031224 predicted 1381
7 SASI_Hs02_00345323 predicted 2072
8 SASI_Hs02_00345324 predicted 2119
9 SASI_Hs01_00031226 predicted 1899
10 SASI_Hs02_00345325 predicted 2098
11 SASI_Hs01_00031221 predicted 897
12 SASI_Hs01_00031225 predicted 1336
13 SASI_Hs01_00031227 predicted 1920
14 SASI_Hs01_00031228 predicted 1441
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139312 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070383 predicted 1391
2 SASI_Hs01_00070384 predicted 1180
3 SASI_Hs02_00364278 predicted 1589
4 SASI_Hs01_00070386 predicted 1645
5 SASI_Hs01_00070387 predicted 1625
6 SASI_Hs01_00070388 predicted 1549
7 SASI_Hs02_00364279 predicted 2248
8 SASI_Hs02_00364280 predicted 2285
9 SASI_Hs01_00070390 predicted 2077
10 SASI_Hs02_00364281 predicted 2276
11 SASI_Hs01_00070385 predicted 1066
12 SASI_Hs01_00070389 predicted 1508
13 SASI_Hs01_00070391 predicted 2090
14 SASI_Hs01_00070392 predicted 1612
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016255 predicted 1402
2 SASI_Hs01_00016256 predicted 1193
3 SASI_Hs01_00016257 predicted 1059
4 SASI_Hs01_00016258 predicted 1652
5 SASI_Hs01_00016259 predicted 1626
6 SASI_Hs01_00016260 predicted 1553
7 SASI_Hs01_00016261 predicted 1501
8 SASI_Hs01_00016262 predicted 2077
9 SASI_Hs01_00016263 predicted 2097
10 SASI_Hs01_00016264 predicted 1604
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053682 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00032440 predicted 1769
2 SASI_Rn02_00266422 predicted 1861
3 SASI_Rn01_00032442 predicted 1464
4 SASI_Rn01_00032444 predicted 1380
5 SASI_Rn01_00032445 predicted 2127
6 SASI_Rn02_00266423 predicted 1428
7 SASI_Rn01_00032446 predicted 381
8 SASI_Rn02_00266424 predicted 2260
9 SASI_Rn01_00032448 predicted 1792
10 SASI_Rn01_00032449 predicted 309
11 SASI_Rn01_00032441 predicted 1619
12 SASI_Rn01_00032443 predicted 2301
13 SASI_Rn01_00032447 predicted 1587
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013771 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322721 predicted 2144
2 SASI_Mm01_00021564 predicted 1601
3 SASI_Mm01_00021565 predicted 1750
4 SASI_Mm02_00322722 predicted 250
5 SASI_Mm01_00021566 predicted 1446
6 SASI_Mm01_00021567 predicted 2109
7 SASI_Mm01_00021568 predicted 1384
8 SASI_Mm01_00021569 predicted 1781
9 SASI_Mm01_00021570 predicted 295
10 SASI_Mm01_00021571 predicted 1270
11 SASI_Mm01_00021562 predicted 490
12 SASI_Mm01_00021563 predicted 1547
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013771
VALIDATED
YME1L1 MISSION shRNA Bacterial Glycerol Stock
YME1-like 1 ATPase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000326051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-766s21c1
Sequence:CCGGGCTCACCAAGATGCATTTAAACTCGAGTTTAAATGCATCTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-339s21c1
Sequence:CCGGCCTTGGATTATCTGAATTGAACTCGAGTTCAATTCAGATAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-633s21c1
Sequence:CCGGGCAGTCTACCTCTGAAAGATTCTCGAGAATCTTTCAGAGGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000326054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-1882s21c1
Sequence:CCGGCCTGAGAATGACAGATGGAATCTCGAGATTCCATCTGTCATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-2171s1c1
Sequence:CCGGCGAGCCAAACATATCTTGAAACTCGAGTTTCAAGATATGTTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-340s1c1
Sequence:CCGGCCTTGGATTATCTGAATTGAACTCGAGTTCAATTCAGATAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-1883s1c1
Sequence:CCGGCCTGAGAATGACAGATGGAATCTCGAGATTCCATCTGTCATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-767s1c1
Sequence:CCGGGCTCACCAAGATGCATTTAAACTCGAGTTTAAATGCATCTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-634s1c1
Sequence:CCGGGCAGTCTACCTCTGAAAGATTCTCGAGAATCTTTCAGAGGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013771
VALIDATED
YME1L1 MISSION shRNA shRNA Plasmid DNA
YME1-like 1 ATPase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000326051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-766s21c1
Sequence:CCGGGCTCACCAAGATGCATTTAAACTCGAGTTTAAATGCATCTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-339s21c1
Sequence:CCGGCCTTGGATTATCTGAATTGAACTCGAGTTCAATTCAGATAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-633s21c1
Sequence:CCGGGCAGTCTACCTCTGAAAGATTCTCGAGAATCTTTCAGAGGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000326054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-1882s21c1
Sequence:CCGGCCTGAGAATGACAGATGGAATCTCGAGATTCCATCTGTCATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-2171s1c1
Sequence:CCGGCGAGCCAAACATATCTTGAAACTCGAGTTTCAAGATATGTTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-340s1c1
Sequence:CCGGCCTTGGATTATCTGAATTGAACTCGAGTTCAATTCAGATAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-1883s1c1
Sequence:CCGGCCTGAGAATGACAGATGGAATCTCGAGATTCCATCTGTCATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-767s1c1
Sequence:CCGGGCTCACCAAGATGCATTTAAACTCGAGTTTAAATGCATCTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-634s1c1
Sequence:CCGGGCAGTCTACCTCTGAAAGATTCTCGAGAATCTTTCAGAGGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013771
VALIDATED
YME1L1 MISSION shRNA Lentiviral Transduction Particles
YME1-like 1 ATPase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000326051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-766s21c1
Sequence:CCGGGCTCACCAAGATGCATTTAAACTCGAGTTTAAATGCATCTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326052    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-339s21c1
Sequence:CCGGCCTTGGATTATCTGAATTGAACTCGAGTTCAATTCAGATAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325980    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-633s21c1
Sequence:CCGGGCAGTCTACCTCTGAAAGATTCTCGAGAATCTTTCAGAGGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000326054    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013771.4-1882s21c1
Sequence:CCGGCCTGAGAATGACAGATGGAATCTCGAGATTCCATCTGTCATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031199    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-2171s1c1
Sequence:CCGGCGAGCCAAACATATCTTGAAACTCGAGTTTCAAGATATGTTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-340s1c1
Sequence:CCGGCCTTGGATTATCTGAATTGAACTCGAGTTCAATTCAGATAATCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031202    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-1883s1c1
Sequence:CCGGCCTGAGAATGACAGATGGAATCTCGAGATTCCATCTGTCATTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-767s1c1
Sequence:CCGGGCTCACCAAGATGCATTTAAACTCGAGTTTAAATGCATCTTGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_013771.2-634s1c1
Sequence:CCGGGCAGTCTACCTCTGAAAGATTCTCGAGAATCTTTCAGAGGTAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014263
VALIDATED
YME1L1 MISSION shRNA Bacterial Glycerol Stock
YME1-like 1 ATPase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1984s21c1
Sequence:CCGGGAGTGGCAGAGGAGCTTATATCTCGAGATATAAGCTCCTCTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1215s21c1
Sequence:CCGGTATGCTTCTGGATCCGAATTTCTCGAGAAATTCGGATCCAGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1815s21c1
Sequence:GTACCGGGGTCATGCCATTATTGCATATCTCGAGATATGCAATAATGGCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1374s21c1
Sequence:CCGGTATTCAAGGCAGACCATAAATCTCGAGATTTATGGTCTGCCTTGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014263.2-2585s21c1
Sequence:CCGGTGAGGAATGTCAATTAGTTATCTCGAGATAACTAATTGACATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014263.2-2706s1c1
Sequence:CCGGGCAGTAATTATGTTCCAGATTCTCGAGAATCTGGAACATAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1260s1c1
Sequence:CCGGGCCAGCCGTATCAGAAATCTTCTCGAGAAGATTTCTGATACGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1261s1c1
Sequence:CCGGCCAGCCGTATCAGAAATCTTTCTCGAGAAAGATTTCTGATACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-673s1c1
Sequence:CCGGCCTCCGAGAGATTAGCTGAAACTCGAGTTTCAGCTAATCTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1853s1c1
Sequence:CCGGGCCTATCAACAAAGCTACAATCTCGAGATTGTAGCTTTGTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014263
VALIDATED
YME1L1 MISSION shRNA shRNA Plasmid DNA
YME1-like 1 ATPase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1984s21c1
Sequence:CCGGGAGTGGCAGAGGAGCTTATATCTCGAGATATAAGCTCCTCTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1215s21c1
Sequence:CCGGTATGCTTCTGGATCCGAATTTCTCGAGAAATTCGGATCCAGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1815s21c1
Sequence:GTACCGGGGTCATGCCATTATTGCATATCTCGAGATATGCAATAATGGCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1374s21c1
Sequence:CCGGTATTCAAGGCAGACCATAAATCTCGAGATTTATGGTCTGCCTTGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014263.2-2585s21c1
Sequence:CCGGTGAGGAATGTCAATTAGTTATCTCGAGATAACTAATTGACATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014263.2-2706s1c1
Sequence:CCGGGCAGTAATTATGTTCCAGATTCTCGAGAATCTGGAACATAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1260s1c1
Sequence:CCGGGCCAGCCGTATCAGAAATCTTCTCGAGAAGATTTCTGATACGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1261s1c1
Sequence:CCGGCCAGCCGTATCAGAAATCTTTCTCGAGAAAGATTTCTGATACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-673s1c1
Sequence:CCGGCCTCCGAGAGATTAGCTGAAACTCGAGTTTCAGCTAATCTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1853s1c1
Sequence:CCGGGCCTATCAACAAAGCTACAATCTCGAGATTGTAGCTTTGTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014263
VALIDATED
YME1L1 MISSION shRNA Lentiviral Transduction Particles
YME1-like 1 ATPase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1984s21c1
Sequence:CCGGGAGTGGCAGAGGAGCTTATATCTCGAGATATAAGCTCCTCTGCCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1215s21c1
Sequence:CCGGTATGCTTCTGGATCCGAATTTCTCGAGAAATTCGGATCCAGAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218524    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1815s21c1
Sequence:GTACCGGGGTCATGCCATTATTGCATATCTCGAGATATGCAATAATGGCATGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229823    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014263.2-1374s21c1
Sequence:CCGGTATTCAAGGCAGACCATAAATCTCGAGATTTATGGTCTGCCTTGAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229825    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014263.2-2585s21c1
Sequence:CCGGTGAGGAATGTCAATTAGTTATCTCGAGATAACTAATTGACATTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073863    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014263.2-2706s1c1
Sequence:CCGGGCAGTAATTATGTTCCAGATTCTCGAGAATCTGGAACATAATTACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1260s1c1
Sequence:CCGGGCCAGCCGTATCAGAAATCTTCTCGAGAAGATTTCTGATACGGCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073866    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1261s1c1
Sequence:CCGGCCAGCCGTATCAGAAATCTTTCTCGAGAAAGATTTCTGATACGGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-673s1c1
Sequence:CCGGCCTCCGAGAGATTAGCTGAAACTCGAGTTTCAGCTAATCTCTCGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A3
TRC Version: 1 Clone ID:NM_014263.2-1853s1c1
Sequence:CCGGGCCTATCAACAAAGCTACAATCTCGAGATTGTAGCTTTGTTGATAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks