EMAIL THIS PAGE TO A FRIEND

YOD1

YOD1 deubiquitinase

Synonyms: DUBA8 OTUD2 PRO0907
UniProtKB ID: Q5VVQ6, B2RNX3, Q5VVQ5, Q6ZRS6, Q86T63, Q9P1L8
Gene ID:
Human(55432) Summary: Protein ubiquitination controls many intracellular processes, including cell cycle progression, transcriptional activation, and signal transduction. This dynamic process, involving ubiquitin conjugating enzymes and deubiquitinating enzymes, adds and removes ubiquitin. Deubiquitinating enzymes are cysteine proteases that specifically cleave ubiquitin from ubiquitin-conjugated protein substrates. The protein encoded by this gene belongs to a DUB subfamily characterized by an ovarian tumor (OTU) domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(226418) YOD1 OTU deubiquitinating enzyme 1 homologue (S. cerevisiae)
Rat(363982) YOD1 deubiquitinase
Zebrafish(550411) YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)
dog(490268) YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)
chicken(428266) YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)
domestic cat(101089828) YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)
Horse(100055976) YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)
domestic guinea pig(100714320) YOD1 deubiquitinase
cow(539931) YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)
sheep(101119065) YOD1 OTU deubiquinating enzyme 1 homolog (S. cerevisiae)
203 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018566 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018566 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018566 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178691 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178691 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178691 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018566 Rosetta Predictions human pricing
NM_001008889 Rosetta Predictions rat pricing
NM_178691 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018566 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00052848 predicted 743
2 SASI_Hs01_00052849 predicted 858
3 SASI_Hs01_00052850 predicted 1177
4 SASI_Hs01_00052851 predicted 415
5 SASI_Hs01_00052852 predicted 967
6 SASI_Hs01_00052854 predicted 708
7 SASI_Hs01_00052855 predicted 592
8 SASI_Hs01_00052856 predicted 1169
9 SASI_Hs01_00052857 predicted 1103
10 SASI_Hs02_00352117 predicted 769
11 SASI_Hs01_00052853 predicted 433
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008889 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00106527 predicted 563
2 SASI_Rn01_00106528 predicted 650
3 SASI_Rn01_00106529 predicted 587
4 SASI_Rn01_00106530 predicted 340
5 SASI_Rn01_00106532 predicted 436
6 SASI_Rn01_00106533 predicted 273
7 SASI_Rn01_00106535 predicted 636
8 SASI_Rn02_00199444 predicted 327
9 SASI_Rn02_00199445 predicted 414
10 SASI_Rn02_00199446 predicted 657
11 SASI_Rn01_00106531 predicted 355
12 SASI_Rn01_00106534 predicted 333
13 SASI_Rn01_00106536 predicted 296
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178691 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00062815 predicted 1301
2 SASI_Mm01_00062816 predicted 1060
3 SASI_Mm01_00062817 predicted 1668
4 SASI_Mm02_00349183 predicted 1552
5 SASI_Mm01_00062819 predicted 476
6 SASI_Mm01_00062820 predicted 1590
7 SASI_Mm01_00062821 predicted 1319
8 SASI_Mm02_00349184 predicted 1303
9 SASI_Mm01_00062822 predicted 1611
10 SASI_Mm02_00349185 predicted 1357
11 SASI_Mm01_00062818 predicted 1371
12 SASI_Mm01_00062823 predicted 1059
13 SASI_Mm01_00062824 predicted 1556
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018566
YOD1 MISSION shRNA Bacterial Glycerol Stock
YOD1 deubiquitinase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000168622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-974s1c1
Sequence:CCGGGTTTACTGATGTCAACCGCTTCTCGAGAAGCGGTTGACATCAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-669s1c1
Sequence:CCGGGAGTACTGTGACTGGATCAAACTCGAGTTTGATCCAGTCACAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-936s1c1
Sequence:CCGGGCACTGGAATTAGCAGATGAACTCGAGTTCATCTGCTAATTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018566.3-3862s1c1
Sequence:CCGGGCAGAATGAAATCTTTCCTATCTCGAGATAGGAAAGATTTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-1017s1c1
Sequence:CCGGCAGAAAGGATTAACTGGACAACTCGAGTTGTCCAGTTAATCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018566.3-5084s1c1
Sequence:CCGGGCACATTTCATTCCACATAAACTCGAGTTTATGTGGAATGAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-427s1c1
Sequence:CCGGCCAGAAGTTCACCTGCATTTACTCGAGTAAATGCAGGTGAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018566
YOD1 MISSION shRNA shRNA Plasmid DNA
YOD1 deubiquitinase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000168622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-974s1c1
Sequence:CCGGGTTTACTGATGTCAACCGCTTCTCGAGAAGCGGTTGACATCAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-669s1c1
Sequence:CCGGGAGTACTGTGACTGGATCAAACTCGAGTTTGATCCAGTCACAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-936s1c1
Sequence:CCGGGCACTGGAATTAGCAGATGAACTCGAGTTCATCTGCTAATTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018566.3-3862s1c1
Sequence:CCGGGCAGAATGAAATCTTTCCTATCTCGAGATAGGAAAGATTTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-1017s1c1
Sequence:CCGGCAGAAAGGATTAACTGGACAACTCGAGTTGTCCAGTTAATCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018566.3-5084s1c1
Sequence:CCGGGCACATTTCATTCCACATAAACTCGAGTTTATGTGGAATGAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-427s1c1
Sequence:CCGGCCAGAAGTTCACCTGCATTTACTCGAGTAAATGCAGGTGAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018566
YOD1 MISSION shRNA Lentiviral Transduction Particles
YOD1 deubiquitinase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000168622    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-974s1c1
Sequence:CCGGGTTTACTGATGTCAACCGCTTCTCGAGAAGCGGTTGACATCAGTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168597    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-669s1c1
Sequence:CCGGGAGTACTGTGACTGGATCAAACTCGAGTTTGATCCAGTCACAGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168282    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-936s1c1
Sequence:CCGGGCACTGGAATTAGCAGATGAACTCGAGTTCATCTGCTAATTCCAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167606    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018566.3-3862s1c1
Sequence:CCGGGCAGAATGAAATCTTTCCTATCTCGAGATAGGAAAGATTTCATTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-1017s1c1
Sequence:CCGGCAGAAAGGATTAACTGGACAACTCGAGTTGTCCAGTTAATCCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167578    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018566.3-5084s1c1
Sequence:CCGGGCACATTTCATTCCACATAAACTCGAGTTTATGTGGAATGAAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168175    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018566.3-427s1c1
Sequence:CCGGCCAGAAGTTCACCTGCATTTACTCGAGTAAATGCAGGTGAACTTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178691
YOD1 MISSION shRNA Bacterial Glycerol Stock
YOD1 deubiquitinase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000113320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178691.2-3207s1c1
Sequence:CCGGGCACCGTATTTATAGAGCTTACTCGAGTAAGCTCTATAAATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-556s1c1
Sequence:CCGGGCTCCTAGTTATGTCAGGGAACTCGAGTTCCCTGACATAACTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-716s1c1
Sequence:CCGGCAAGTGATCCAGTCTTGTATACTCGAGTATACAAGACTGGATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-813s1c1
Sequence:CCGGCGAGATCTCAATCCTGTCTAACTCGAGTTAGACAGGATTGAGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000113321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-703s1c1
Sequence:CCGGGCACAAATTGTAGCAAGTGATCTCGAGATCACTTGCTACAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178691
YOD1 MISSION shRNA shRNA Plasmid DNA
YOD1 deubiquitinase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000113320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178691.2-3207s1c1
Sequence:CCGGGCACCGTATTTATAGAGCTTACTCGAGTAAGCTCTATAAATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-556s1c1
Sequence:CCGGGCTCCTAGTTATGTCAGGGAACTCGAGTTCCCTGACATAACTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-716s1c1
Sequence:CCGGCAAGTGATCCAGTCTTGTATACTCGAGTATACAAGACTGGATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-813s1c1
Sequence:CCGGCGAGATCTCAATCCTGTCTAACTCGAGTTAGACAGGATTGAGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000113321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-703s1c1
Sequence:CCGGGCACAAATTGTAGCAAGTGATCTCGAGATCACTTGCTACAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178691
YOD1 MISSION shRNA Lentiviral Transduction Particles
YOD1 deubiquitinase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000113320    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178691.2-3207s1c1
Sequence:CCGGGCACCGTATTTATAGAGCTTACTCGAGTAAGCTCTATAAATACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113322    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-556s1c1
Sequence:CCGGGCTCCTAGTTATGTCAGGGAACTCGAGTTCCCTGACATAACTAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113323    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-716s1c1
Sequence:CCGGCAAGTGATCCAGTCTTGTATACTCGAGTATACAAGACTGGATCACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113324    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-813s1c1
Sequence:CCGGCGAGATCTCAATCCTGTCTAACTCGAGTTAGACAGGATTGAGATCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000113321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178691.2-703s1c1
Sequence:CCGGGCACAAATTGTAGCAAGTGATCTCGAGATCACTTGCTACAATTTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks