EMAIL THIS PAGE TO A FRIEND

YPEL1

yippee-like 1 (Drosophila)

UniProtKB ID: O60688, Q65ZA1, Q6GLI6
Gene ID:
Human(29799) Summary: This gene encodes a potential zinc-binding protein and is located in the region associated with DiGeorge syndrome on chromosome 22. The encoded protein may play a role in the regulation of cellular morphology and may function during craniofacial development. [provided by RefSeq, Jul 2008]
Mouse(106369) yippee-like 1 (Drosophila)
Rat(100360867) yippee-like 1 (Drosophila)
Zebrafish(554488) yippee-like 1 (Drosophila)
dog(608652) yippee-like 1 (Drosophila)
domestic cat(101087356) yippee-like 1 (Drosophila)
chicken(416774) yippee-like 1 (Drosophila)
cow(521410) yippee-like 1 (Drosophila)
sheep(101119936) yippee-like 1 (Drosophila)
domestic guinea pig(100734302) yippee-like 1 (Drosophila)
naked mole-rat(101704884) yippee-like 1 (Drosophila)
31 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301809 Anti-YPEL1 affinity isolated antibody human
immunohistochemistry pricing
SAB1302466 ANTI-YPEL1 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing
SAB3500655 Anti-YPEL1 antibody produced in rabbit affinity isolated antibody mouse, rat, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023249 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023249 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023249 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_013313 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013313 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013313 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU144981 MISSION® esiRNA esiRNA human YPEL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013313 Rosetta Predictions human pricing
NM_023249 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013313 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00070893 predicted 423
2 SASI_Hs01_00070894 predicted 668
3 SASI_Hs01_00070895 predicted 691
4 SASI_Hs02_00344601 predicted 652
5 SASI_Hs01_00070896 predicted 370
6 SASI_Hs01_00070897 predicted 752
7 SASI_Hs01_00070898 predicted 782
8 SASI_Hs01_00070899 predicted 804
9 SASI_Hs01_00070900 predicted 592
10 SASI_Hs01_00070901 predicted 819
11 SASI_Hs01_00070902 predicted 681
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023249 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00146864 predicted 633
2 SASI_Mm01_00146865 predicted 1005
3 SASI_Mm01_00146866 predicted 935
4 SASI_Mm01_00146867 predicted 938
5 SASI_Mm01_00146868 predicted 727
6 SASI_Mm01_00146869 predicted 912
7 SASI_Mm01_00146870 predicted 687
8 SASI_Mm01_00146871 predicted 552
9 SASI_Mm02_00327003 predicted 269
10 SASI_Mm02_00327004 predicted 790
11 SASI_Mm01_00146862 predicted 651
12 SASI_Mm01_00146863 predicted 641
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023249
YPEL1 MISSION shRNA Bacterial Glycerol Stock
yippee-like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023249.2-1469s1c1
Sequence:CCGGCCCAGATAAGTTTCATTGTTTCTCGAGAAACAATGAAACTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-265s1c1
Sequence:CCGGTCACCGAACTTACAGCTGCATCTCGAGATGCAGCTGTAAGTTCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-361s1c1
Sequence:CCGGCCTCTTCAACTCTGTGGTGAACTCGAGTTCACCACAGAGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-470s1c1
Sequence:CCGGCTCGGGTGGAAATACGAACATCTCGAGATGTTCGTATTTCCACCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-438s1c1
Sequence:CCGGCCGACATCTACTGTGAGAACTCTCGAGAGTTCTCACAGTAGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023249
YPEL1 MISSION shRNA shRNA Plasmid DNA
yippee-like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023249.2-1469s1c1
Sequence:CCGGCCCAGATAAGTTTCATTGTTTCTCGAGAAACAATGAAACTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-265s1c1
Sequence:CCGGTCACCGAACTTACAGCTGCATCTCGAGATGCAGCTGTAAGTTCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-361s1c1
Sequence:CCGGCCTCTTCAACTCTGTGGTGAACTCGAGTTCACCACAGAGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-470s1c1
Sequence:CCGGCTCGGGTGGAAATACGAACATCTCGAGATGTTCGTATTTCCACCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-438s1c1
Sequence:CCGGCCGACATCTACTGTGAGAACTCTCGAGAGTTCTCACAGTAGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023249
YPEL1 MISSION shRNA Lentiviral Transduction Particles
yippee-like 1 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126489    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023249.2-1469s1c1
Sequence:CCGGCCCAGATAAGTTTCATTGTTTCTCGAGAAACAATGAAACTTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126493    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-265s1c1
Sequence:CCGGTCACCGAACTTACAGCTGCATCTCGAGATGCAGCTGTAAGTTCGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-361s1c1
Sequence:CCGGCCTCTTCAACTCTGTGGTGAACTCGAGTTCACCACAGAGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126491    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-470s1c1
Sequence:CCGGCTCGGGTGGAAATACGAACATCTCGAGATGTTCGTATTTCCACCCGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023249.2-438s1c1
Sequence:CCGGCCGACATCTACTGTGAGAACTCTCGAGAGTTCTCACAGTAGATGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013313
YPEL1 MISSION shRNA Bacterial Glycerol Stock
yippee-like 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000154345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013313.3-2059s1c1
Sequence:CCGGCCCTGGATGTACTTGAAGAAACTCGAGTTTCTTCAAGTACATCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-424s1c1
Sequence:CCGGCCAATCATGACGAGCTCATCTCTCGAGAGATGAGCTCGTCATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013313.3-671s1c1
Sequence:CCGGCAAAGACAATGGCTGGGAGTACTCGAGTACTCCCAGCCATTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-593s1c1
Sequence:CCGGGTGGAAATACGAGCATGCCTTCTCGAGAAGGCATGCTCGTATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013313.3-435s1c1
Sequence:CCGGGAGCTCATCTCCAAGTCCTTTCTCGAGAAAGGACTTGGAGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-609s1c1
Sequence:CCGGGCCTTTGAGAGCAGTCAGAAACTCGAGTTTCTGACTGCTCTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-437s1c1
Sequence:CCGGGCTCATCTCCAAGTCCTTTCACTCGAGTGAAAGGACTTGGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013313.3-384s21c1
Sequence:CCGGCACCGAACGTACAGCTGTATCCTCGAGGATACAGCTGTACGTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013313.3-685s21c1
Sequence:CCGGGGGAGTAATGTGCGAACTTTCCTCGAGGAAAGTTCGCACATTACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013313
YPEL1 MISSION shRNA shRNA Plasmid DNA
yippee-like 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000154345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013313.3-2059s1c1
Sequence:CCGGCCCTGGATGTACTTGAAGAAACTCGAGTTTCTTCAAGTACATCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-424s1c1
Sequence:CCGGCCAATCATGACGAGCTCATCTCTCGAGAGATGAGCTCGTCATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013313.3-671s1c1
Sequence:CCGGCAAAGACAATGGCTGGGAGTACTCGAGTACTCCCAGCCATTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-593s1c1
Sequence:CCGGGTGGAAATACGAGCATGCCTTCTCGAGAAGGCATGCTCGTATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013313.3-435s1c1
Sequence:CCGGGAGCTCATCTCCAAGTCCTTTCTCGAGAAAGGACTTGGAGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-609s1c1
Sequence:CCGGGCCTTTGAGAGCAGTCAGAAACTCGAGTTTCTGACTGCTCTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-437s1c1
Sequence:CCGGGCTCATCTCCAAGTCCTTTCACTCGAGTGAAAGGACTTGGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013313.3-384s21c1
Sequence:CCGGCACCGAACGTACAGCTGTATCCTCGAGGATACAGCTGTACGTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013313.3-685s21c1
Sequence:CCGGGGGAGTAATGTGCGAACTTTCCTCGAGGAAAGTTCGCACATTACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013313
YPEL1 MISSION shRNA Lentiviral Transduction Particles
yippee-like 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000154345    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013313.3-2059s1c1
Sequence:CCGGCCCTGGATGTACTTGAAGAAACTCGAGTTTCTTCAAGTACATCCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157987    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-424s1c1
Sequence:CCGGCCAATCATGACGAGCTCATCTCTCGAGAGATGAGCTCGTCATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157911    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013313.3-671s1c1
Sequence:CCGGCAAAGACAATGGCTGGGAGTACTCGAGTACTCCCAGCCATTGTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157604    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-593s1c1
Sequence:CCGGGTGGAAATACGAGCATGCCTTCTCGAGAAGGCATGCTCGTATTTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013313.3-435s1c1
Sequence:CCGGGAGCTCATCTCCAAGTCCTTTCTCGAGAAAGGACTTGGAGATGAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-609s1c1
Sequence:CCGGGCCTTTGAGAGCAGTCAGAAACTCGAGTTTCTGACTGCTCTCAAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013313.3-437s1c1
Sequence:CCGGGCTCATCTCCAAGTCCTTTCACTCGAGTGAAAGGACTTGGAGATGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436899    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013313.3-384s21c1
Sequence:CCGGCACCGAACGTACAGCTGTATCCTCGAGGATACAGCTGTACGTTCGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418131    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013313.3-685s21c1
Sequence:CCGGGGGAGTAATGTGCGAACTTTCCTCGAGGAAAGTTCGCACATTACTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks