EMAIL THIS PAGE TO A FRIEND

YPEL2

yippee-like 2 (Drosophila)

UniProtKB ID: Q96QA6, A0PK16, A2RUG4, Q65ZA0, Q8N3W2
Gene ID:
Mouse(77864) yippee-like 2 (Drosophila)
naked mole-rat(101719379) yippee-like 2 (Drosophila)
domestic guinea pig(100721242) yippee-like 2 (Drosophila)
cow(616180) yippee-like 2 (Drosophila)
sheep(101104253) yippee-like 2 (Drosophila)
chicken(417632) yippee-like 2 (Drosophila)
domestic cat(101094146) yippee-like 2 (Drosophila)
dog(610066) yippee-like 2 (Drosophila)
254 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301811 Anti-YPEL2 affinity isolated antibody human, mouse
immunohistochemistry pricing
SAB1301308 ANTI-YPEL2 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
immunohistochemistry, western blot pricing
SAB3500656 Anti-YPEL2 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, immunocytochemistry, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005404 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005404 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005404 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001005341 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005341 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005341 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU046931 MISSION® esiRNA esiRNA human YPEL2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005404 Rosetta Predictions human pricing
NM_001005341 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005404 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107713 predicted 586
2 SASI_Hs01_00107714 predicted 426
3 SASI_Hs01_00107715 predicted 412
4 SASI_Hs01_00107716 predicted 861
5 SASI_Hs01_00107718 predicted 419
6 SASI_Hs01_00107720 predicted 471
7 SASI_Hs01_00107721 predicted 512
8 SASI_Hs02_00304891 predicted 652
9 SASI_Hs01_00107722 predicted 838
10 SASI_Hs02_00304892 predicted 725
11 SASI_Hs01_00107717 predicted 441
12 SASI_Hs01_00107719 predicted 408
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005341 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00046811 predicted 670
2 SASI_Mm02_00286563 predicted 878
3 SASI_Mm02_00286564 predicted 942
4 SASI_Mm02_00286565 predicted 695
5 SASI_Mm02_00286566 predicted 949
6 SASI_Mm02_00286567 predicted 793
7 SASI_Mm02_00286568 predicted 451
8 SASI_Mm02_00286569 predicted 452
9 SASI_Mm02_00286570 predicted 754
10 SASI_Mm02_00286571 predicted 420
11 SASI_Mm01_00046803 predicted 197
12 SASI_Mm01_00046804 predicted 233
13 SASI_Mm01_00046805 predicted 229
14 SASI_Mm01_00046806 predicted 225
15 SASI_Mm01_00046807 predicted 216
16 SASI_Mm01_00046808 predicted 209
17 SASI_Mm01_00046809 predicted 231
18 SASI_Mm01_00046810 predicted 208
19 SASI_Mm01_00046812 predicted 295
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005404
VALIDATED
YPEL2 MISSION shRNA Bacterial Glycerol Stock
yippee-like 2 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005404.3-724s21c1
Sequence:CCGGACGCCATTCAACCGAACATTCCTCGAGGAATGTTCGGTTGAATGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-656s21c1
Sequence:CCGGGCACACATGATCAAGGACAATCTCGAGATTGTCCTTGATCATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-444s21c1
Sequence:CCGGAGTCATTCCAAGGAAGTCAAGCTCGAGCTTGACTTCCTTGGAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-463s21c1
Sequence:CCGGAGGACGAGCATACCTCTTTAACTCGAGTTAAAGAGGTATGCTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-431s21c1
Sequence:CCGGGAACTAATTTCCAAGTCATTCCTCGAGGAATGACTTGGAAATTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005404.3-1150s1c1
Sequence:CCGGCCTGATAACTTAGGCTTGAAACTCGAGTTTCAAGCCTAAGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-475s1c1
Sequence:CCGGCCTCTTTAACTCAGTAGTTAACTCGAGTTAACTACTGAGTTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-643s1c1
Sequence:CCGGCATCATTGAACTAGCACACATCTCGAGATGTGTGCTAGTTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005404.3-417s1c1
Sequence:CCGGTGGCCAATCATGATGAACTAACTCGAGTTAGTTCATCATGATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-524s1c1
Sequence:CCGGGTGTTGCTAACAGGACTGCATCTCGAGATGCAGTCCTGTTAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005404
VALIDATED
YPEL2 MISSION shRNA shRNA Plasmid DNA
yippee-like 2 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005404.3-724s21c1
Sequence:CCGGACGCCATTCAACCGAACATTCCTCGAGGAATGTTCGGTTGAATGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-656s21c1
Sequence:CCGGGCACACATGATCAAGGACAATCTCGAGATTGTCCTTGATCATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-444s21c1
Sequence:CCGGAGTCATTCCAAGGAAGTCAAGCTCGAGCTTGACTTCCTTGGAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-463s21c1
Sequence:CCGGAGGACGAGCATACCTCTTTAACTCGAGTTAAAGAGGTATGCTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-431s21c1
Sequence:CCGGGAACTAATTTCCAAGTCATTCCTCGAGGAATGACTTGGAAATTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005404.3-1150s1c1
Sequence:CCGGCCTGATAACTTAGGCTTGAAACTCGAGTTTCAAGCCTAAGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-475s1c1
Sequence:CCGGCCTCTTTAACTCAGTAGTTAACTCGAGTTAACTACTGAGTTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-643s1c1
Sequence:CCGGCATCATTGAACTAGCACACATCTCGAGATGTGTGCTAGTTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005404.3-417s1c1
Sequence:CCGGTGGCCAATCATGATGAACTAACTCGAGTTAGTTCATCATGATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-524s1c1
Sequence:CCGGGTGTTGCTAACAGGACTGCATCTCGAGATGCAGTCCTGTTAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005404
VALIDATED
YPEL2 MISSION shRNA Lentiviral Transduction Particles
yippee-like 2 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442655    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005404.3-724s21c1
Sequence:CCGGACGCCATTCAACCGAACATTCCTCGAGGAATGTTCGGTTGAATGGCGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426625    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-656s21c1
Sequence:CCGGGCACACATGATCAAGGACAATCTCGAGATTGTCCTTGATCATGTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-444s21c1
Sequence:CCGGAGTCATTCCAAGGAAGTCAAGCTCGAGCTTGACTTCCTTGGAATGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424276    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-463s21c1
Sequence:CCGGAGGACGAGCATACCTCTTTAACTCGAGTTAAAGAGGTATGCTCGTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454958    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005404.3-431s21c1
Sequence:CCGGGAACTAATTTCCAAGTCATTCCTCGAGGAATGACTTGGAAATTAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116237    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005404.3-1150s1c1
Sequence:CCGGCCTGATAACTTAGGCTTGAAACTCGAGTTTCAAGCCTAAGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116238    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-475s1c1
Sequence:CCGGCCTCTTTAACTCAGTAGTTAACTCGAGTTAACTACTGAGTTAAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116239    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-643s1c1
Sequence:CCGGCATCATTGAACTAGCACACATCTCGAGATGTGTGCTAGTTCAATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001005404.3-417s1c1
Sequence:CCGGTGGCCAATCATGATGAACTAACTCGAGTTAGTTCATCATGATTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005404.3-524s1c1
Sequence:CCGGGTGTTGCTAACAGGACTGCATCTCGAGATGCAGTCCTGTTAGCAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005341
YPEL2 MISSION shRNA Bacterial Glycerol Stock
yippee-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-720s21c1
Sequence:CCGGTGGGACTGACCTGATAGCATCCTCGAGGATGCTATCAGGTCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-565s21c1
Sequence:CCGGTGTTGCTAACAGGACTACATGCTCGAGCATGTAGTCCTGTTAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005341.3-2062s21c1
Sequence:CCGGTTGCATCAATCCAGCTATTATCTCGAGATAATAGCTGGATTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-454s21c1
Sequence:CCGGACTTGGCCAATCACGACGAACCTCGAGGTTCGTCGTGATTGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-675s21c1
Sequence:CCGGGGCAAATACATCATTGAATTACTCGAGTAATTCAATGATGTATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005341
YPEL2 MISSION shRNA shRNA Plasmid DNA
yippee-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-720s21c1
Sequence:CCGGTGGGACTGACCTGATAGCATCCTCGAGGATGCTATCAGGTCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-565s21c1
Sequence:CCGGTGTTGCTAACAGGACTACATGCTCGAGCATGTAGTCCTGTTAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005341.3-2062s21c1
Sequence:CCGGTTGCATCAATCCAGCTATTATCTCGAGATAATAGCTGGATTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-454s21c1
Sequence:CCGGACTTGGCCAATCACGACGAACCTCGAGGTTCGTCGTGATTGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-675s21c1
Sequence:CCGGGGCAAATACATCATTGAATTACTCGAGTAATTCAATGATGTATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005341
YPEL2 MISSION shRNA Lentiviral Transduction Particles
yippee-like 2 (Drosophila)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252123    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-720s21c1
Sequence:CCGGTGGGACTGACCTGATAGCATCCTCGAGGATGCTATCAGGTCAGTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-565s21c1
Sequence:CCGGTGTTGCTAACAGGACTACATGCTCGAGCATGTAGTCCTGTTAGCAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252126    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005341.3-2062s21c1
Sequence:CCGGTTGCATCAATCCAGCTATTATCTCGAGATAATAGCTGGATTGATGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252124    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-454s21c1
Sequence:CCGGACTTGGCCAATCACGACGAACCTCGAGGTTCGTCGTGATTGGCCAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005341.3-675s21c1
Sequence:CCGGGGCAAATACATCATTGAATTACTCGAGTAATTCAATGATGTATTTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks